|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103327431 NCBI Gene Symbol: LOC103327431 |
| Gene Aliases | |
| Gene description & Other designations | Description: V-type proton ATPase catalytic subunit A Other designations: V-type proton ATPase catalytic subunit A |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: minus Exon count: 20 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 1591011 ...... 1597067 |
| CDS Sequence | 103327431 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (AGGTGA)2 |
| Repeat start & end within CDS | Repeat start: 429 Repeat end: 440 |
| Forward primer | Primer sequence: CCACGTGGTGTATCTGTCCC Tm(°C): 60.108 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: AGAACACGCTGTCCAGTGAG Tm(°C): 59.967 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 363 End: 706 Product size (bp): 344 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103327431 NCBI Gene Symbol: LOC103327431 |
| Gene Aliases | |
| Gene description & Other designations | Description: V-type proton ATPase catalytic subunit A Other designations: V-type proton ATPase catalytic subunit A |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: minus Exon count: 20 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 1591011 ...... 1597067 |
| CDS Sequence | 103327431 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (GAAAT)2 |
| Repeat start & end within CDS | Repeat start: 848 Repeat end: 857 |
| Forward primer | Primer sequence: TTCCTGGGGCTTTTGGTTGT Tm(°C): 60.032 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: GCTTCAGCCCATCGAGAAGT Tm(°C): 60.108 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 748 End: 1078 Product size (bp): 331 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103327431 NCBI Gene Symbol: LOC103327431 |
| Gene Aliases | |
| Gene description & Other designations | Description: V-type proton ATPase catalytic subunit A Other designations: V-type proton ATPase catalytic subunit A |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: minus Exon count: 20 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 1591011 ...... 1597067 |
| CDS Sequence | 103327431 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: ACGGAATCCAGAGGCCTTTG Tm(°C): 60.035 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: ACAACCAAAAGCCCCAGGAA Tm(°C): 60.032 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 307 End: 767 Product size (bp): 461 |
| JBrowse View | JBrowse |
