Statistics
Number of enzymes: 1
Total Number of designed primers: 4
Number of PGTM primers: 1
Number of PMTM primers: 3
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103333478 NCBI Gene Symbol: LOC103333478 |
| Gene Aliases | |
| Gene description & Other designations | Description: V-type proton ATPase subunit H Other designations: V-type proton ATPase subunit H |
| Chromosome, Strand & Exon count | Chromosome: LG5 Strand: plus Exon count: 12 |
| Gene Location within genomic sequence | Genomic accession No. NC_024130.1 Gene Start and end within genomic accession: 24699945 ...... 24704182 |
| CDS Sequence | 103333478 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (AAGAG)2 |
| Repeat start & end within CDS | Repeat start: 362 Repeat end: 371 |
| Forward primer | Primer sequence: ACGGCCCTGCTTATGTTCAA Tm(°C): 59.962 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: ACAGTGCCATCTTGGGGTTT Tm(°C): 59.812 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 157 End: 427 Product size (bp): 271 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103333478 NCBI Gene Symbol: LOC103333478 |
| Gene Aliases | |
| Gene description & Other designations | Description: V-type proton ATPase subunit H Other designations: V-type proton ATPase subunit H |
| Chromosome, Strand & Exon count | Chromosome: LG5 Strand: plus Exon count: 12 |
| Gene Location within genomic sequence | Genomic accession No. NC_024130.1 Gene Start and end within genomic accession: 24699945 ...... 24704182 |
| CDS Sequence | 103333478 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (TCCTA)2 |
| Repeat start & end within CDS | Repeat start: 710 Repeat end: 719 |
| Forward primer | Primer sequence: CCCAACTGCTGTCAATTGCC Tm(°C): 60.038 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CGTCCCTTTGGAGAGCAAGT Tm(°C): 59.965 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 548 End: 854 Product size (bp): 307 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103333478 NCBI Gene Symbol: LOC103333478 |
| Gene Aliases | |
| Gene description & Other designations | Description: V-type proton ATPase subunit H Other designations: V-type proton ATPase subunit H |
| Chromosome, Strand & Exon count | Chromosome: LG5 Strand: plus Exon count: 12 |
| Gene Location within genomic sequence | Genomic accession No. NC_024130.1 Gene Start and end within genomic accession: 24699945 ...... 24704182 |
| CDS Sequence | 103333478 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (GTT)3 |
| Repeat start & end within CDS | Repeat start: 814 Repeat end: 822 |
| Forward primer | Primer sequence: CCCAACTGCTGTCAATTGCC Tm(°C): 60.038 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CGTCCCTTTGGAGAGCAAGT Tm(°C): 59.965 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 548 End: 854 Product size (bp): 307 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103333478 NCBI Gene Symbol: LOC103333478 |
| Gene Aliases | |
| Gene description & Other designations | Description: V-type proton ATPase subunit H Other designations: V-type proton ATPase subunit H |
| Chromosome, Strand & Exon count | Chromosome: LG5 Strand: plus Exon count: 12 |
| Gene Location within genomic sequence | Genomic accession No. NC_024130.1 Gene Start and end within genomic accession: 24699945 ...... 24704182 |
| CDS Sequence | 103333478 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: AATGGCTTTGTGCACAGCTG Tm(°C): 59.967 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: CGTCCCTTTGGAGAGCAAGT Tm(°C): 59.965 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 499 End: 854 Product size (bp): 356 |
| JBrowse View | JBrowse |
