Statistics
Number of enzymes: 1
Total Number of designed primers: 4
Number of PGTM primers: 3
Number of PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103320535 NCBI Gene Symbol: LOC103320535 |
| Gene Aliases | |
| Gene description & Other designations | Description: uncharacterized LOC103320535 Other designations: uncharacterized protein LOC103320535 |
| Chromosome, Strand & Exon count | Chromosome: LG2 Strand: minus Exon count: 3 |
| Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 11262938 ...... 11263883 |
| CDS Sequence | 103320535 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (GTG)3 |
| Repeat start & end within CDS | Repeat start: 320 Repeat end: 328 |
| Forward primer | Primer sequence: GCTGGTTCAATTGCAAGGCA Tm(°C): 59.966 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: ACCAGTGAATTTAAATCCCCGA Tm(°C): 57.69 GC (%): 40.909 Size: 22 |
| Primer start, end within sequence and product size | Start: 14 End: 359 Product size (bp): 346 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103320535 NCBI Gene Symbol: LOC103320535 |
| Gene Aliases | |
| Gene description & Other designations | Description: uncharacterized LOC103320535 Other designations: uncharacterized protein LOC103320535 |
| Chromosome, Strand & Exon count | Chromosome: LG2 Strand: minus Exon count: 3 |
| Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 11262938 ...... 11263883 |
| CDS Sequence | 103320535 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GCTGGTTCAATTGCAAGGCA Tm(°C): 59.966 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: AACCTCCTTCCGCAACGATT Tm(°C): 59.964 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 14 End: 221 Product size (bp): 208 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103340766 NCBI Gene Symbol: LOC103340766 |
| Gene Aliases | |
| Gene description & Other designations | Description: uncharacterized LOC103340766 Other designations: uncharacterized protein LOC103340766 |
| Chromosome, Strand & Exon count | Chromosome: LG8 Strand: plus Exon count: 3 |
| Gene Location within genomic sequence | Genomic accession No. NC_024133.1 Gene Start and end within genomic accession: 14256297 ...... 14258610 |
| CDS Sequence | 103340766 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: CGCCAGTTGCAATCTAAGGC Tm(°C): 59.901 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CACTCCAGCCCAAACAAAGC Tm(°C): 59.967 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 15 End: 301 Product size (bp): 287 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103327731 NCBI Gene Symbol: LOC103327731 |
| Gene Aliases | |
| Gene description & Other designations | Description: uncharacterized LOC103327731 Other designations: uncharacterized protein LOC103327731 |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: plus Exon count: 3 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 3658067 ...... 3660806 |
| CDS Sequence | 103327731 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: AGAAGGTGGTTCAGGCATCG Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: AGCAGCAAGACCAGCATTCT Tm(°C): 59.962 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 25 End: 281 Product size (bp): 257 |
| JBrowse View | JBrowse |
