image


Statistics

Number of enzymes: 1
Total Number of designed primers: 3
Number of PGTM primers:     1
Number of PMTM primers:     2

Enzyme Id:  K02138
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103332405     NCBI Gene Symbol: LOC103332405
Gene Aliases
Gene description & Other designations Description:   ATP synthase subunit d; mitochondrial      Other designations:   ATP synthase subunit d; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   minus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 19377214 ...... 19379614
CDS Sequence 103332405
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (GAACCT)2attgactgggagtattat(AGGAA)2
Repeat start & end within CDS Repeat start: 172     Repeat end: 211
Forward primer Primer sequence:   ATGGCCAAGCTTCTGGTCTC     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACTCAGGAGTGACCGTGTCT     Tm(°C): 60.179     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 69     End: 294     Product size (bp): 226
JBrowse View      JBrowse

Enzyme Id:  K02138
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103332405     NCBI Gene Symbol: LOC103332405
Gene Aliases
Gene description & Other designations Description:   ATP synthase subunit d; mitochondrial      Other designations:   ATP synthase subunit d; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   minus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 19377214 ...... 19379614
CDS Sequence 103332405
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (GAA)3gataagcaccatgactgcagatgagtactttgagaagcatccagagct(
GAA)3
Repeat start & end within CDS Repeat start: 402     Repeat end: 467
Forward primer Primer sequence:   AGGAATTGGGTCTCGCTTGG     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GCCCCAGTAGTCATTTCGGA     Tm(°C): 59.46     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 206     End: 500     Product size (bp): 295
JBrowse View      JBrowse

Enzyme Id:  K02138
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103332405     NCBI Gene Symbol: LOC103332405
Gene Aliases
Gene description & Other designations Description:   ATP synthase subunit d; mitochondrial      Other designations:   ATP synthase subunit d; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   minus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 19377214 ...... 19379614
CDS Sequence 103332405
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   ATGGCCAAGCTTCTGGTCTC     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCAAGCGAGACCCAATTCCT     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 69     End: 225     Product size (bp): 157
JBrowse View      JBrowse