|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103330470 NCBI Gene Symbol: LOC103330470 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase subunit O; mitochondrial Other designations: ATP synthase subunit O; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG5 Strand: plus Exon count: 6 |
| Gene Location within genomic sequence | Genomic accession No. NC_024130.1 Gene Start and end within genomic accession: 312149 ...... 316574 |
| CDS Sequence | 103330470 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: CGAGCCTTCCTCTCGTAACC Tm(°C): 59.899 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: TCCCAGAACCCCCAAACAAC Tm(°C): 60.106 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 25 End: 213 Product size (bp): 189 |
| JBrowse View | JBrowse |
