Statistics
Number of enzymes: 1
Total Number of designed primers: 2
Number of PGTM primers: 1
Number of PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103338581 NCBI Gene Symbol: LOC103338581 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase subunit gamma; mitochondrial Other designations: ATP synthase subunit gamma; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG7 Strand: minus Exon count: 9 |
| Gene Location within genomic sequence | Genomic accession No. NC_024132.1 Gene Start and end within genomic accession: 15249383 ...... 15254256 |
| CDS Sequence | 103338581 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Di Repeat sequence: (GA)4 |
| Repeat start & end within CDS | Repeat start: 667 Repeat end: 674 |
| Forward primer | Primer sequence: CTGCCAACAGTGTCTACCGT Tm(°C): 59.966 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GGCAGACATCCTTGCTCCTT Tm(°C): 60.035 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 627 End: 839 Product size (bp): 213 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103338581 NCBI Gene Symbol: LOC103338581 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase subunit gamma; mitochondrial Other designations: ATP synthase subunit gamma; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG7 Strand: minus Exon count: 9 |
| Gene Location within genomic sequence | Genomic accession No. NC_024132.1 Gene Start and end within genomic accession: 15249383 ...... 15254256 |
| CDS Sequence | 103338581 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: CTGCCAACAGTGTCTACCGT Tm(°C): 59.966 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GGCAGACATCCTTGCTCCTT Tm(°C): 60.035 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 627 End: 839 Product size (bp): 213 |
| JBrowse View | JBrowse |
