|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103328731 NCBI Gene Symbol: LOC103328731 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase subunit epsilon; mitochondrial Other designations: ATP synthase subunit epsilon; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: plus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 13551356 ...... 13553591 |
| CDS Sequence | 103328731 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GGAATTGCCTCAAGGAGCCT Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CTGTACGGATAGTGGGCGTC Tm(°C): 59.97 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 85 End: 195 Product size (bp): 111 |
| JBrowse View | JBrowse |
