Statistics
Number of enzymes: 1
Total Number of designed primers: 3
Number of PGTM primers: 2
Number of PMTM primers: 1
Number of Failed designed PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103331497 NCBI Gene Symbol: LOC103331497 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase subunit delta'; mitochondrial-like Other designations: ATP synthase subunit delta'; mitochondrial-like |
| Chromosome, Strand & Exon count | Chromosome: LG5 Strand: minus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_024130.1 Gene Start and end within genomic accession: 12348851 ...... 12352361 |
| CDS Sequence | 103331497 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (AGCTC)2 |
| Repeat start & end within CDS | Repeat start: 512 Repeat end: 521 |
| Forward primer | Primer sequence: AGAAGGGGCTTGCAGAGTTC Tm(°C): 59.963 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GCGGCATTGAGGGCACTAT Tm(°C): 60.527 GC (%): 57.895 Size: 19 |
| Primer start, end within sequence and product size | Start: 484 End: 589 Product size (bp): 106 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103331497 NCBI Gene Symbol: LOC103331497 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase subunit delta'; mitochondrial-like Other designations: ATP synthase subunit delta'; mitochondrial-like |
| Chromosome, Strand & Exon count | Chromosome: LG5 Strand: minus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_024130.1 Gene Start and end within genomic accession: 12348851 ...... 12352361 |
| CDS Sequence | 103331497 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (GCGCC)2 |
| Repeat start & end within CDS | Repeat start: 6 Repeat end: 15 |
| Forward primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Reverse primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Primer start, end within sequence and product size | Start: End: Product size (bp): |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103331497 NCBI Gene Symbol: LOC103331497 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase subunit delta'; mitochondrial-like Other designations: ATP synthase subunit delta'; mitochondrial-like |
| Chromosome, Strand & Exon count | Chromosome: LG5 Strand: minus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_024130.1 Gene Start and end within genomic accession: 12348851 ...... 12352361 |
| CDS Sequence | 103331497 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: AAACTCCAGTAGCCGACACG Tm(°C): 60.039 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: AGCTTCTGGGTGAACTCTGC Tm(°C): 59.964 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 79 End: 514 Product size (bp): 436 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103328881 NCBI Gene Symbol: LOC103328881 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase subunit delta'; mitochondrial Other designations: ATP synthase subunit delta'; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: minus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 14848019 ...... 14849962 |
| CDS Sequence | 103328881 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GAAGGGAGCGAAGTGACCAA Tm(°C): 59.965 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TGGCTGAACTGAGCTTCTGG Tm(°C): 59.964 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 369 End: 534 Product size (bp): 166 |
| JBrowse View | JBrowse |
