|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103338731 NCBI Gene Symbol: LOC103338731 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase subunit beta; mitochondrial Other designations: ATP synthase subunit beta; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG7 Strand: minus Exon count: 18 |
| Gene Location within genomic sequence | Genomic accession No. NC_024132.1 Gene Start and end within genomic accession: 16110879 ...... 16119030 |
| CDS Sequence | 103338731 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (GTTGA)2 |
| Repeat start & end within CDS | Repeat start: 1504 Repeat end: 1513 |
| Forward primer | Primer sequence: ACTGTTGCTCGTGCTCGTAA Tm(°C): 59.968 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: CAGAACTCCCTGGAAGCTGG Tm(°C): 60.036 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 1416 End: 1544 Product size (bp): 129 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103338731 NCBI Gene Symbol: LOC103338731 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase subunit beta; mitochondrial Other designations: ATP synthase subunit beta; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG7 Strand: minus Exon count: 18 |
| Gene Location within genomic sequence | Genomic accession No. NC_024132.1 Gene Start and end within genomic accession: 16110879 ...... 16119030 |
| CDS Sequence | 103338731 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GGCTCCAGCAACCACTTTTG Tm(°C): 59.967 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TTACGAGCACGAGCAACAGT Tm(°C): 59.968 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 1169 End: 1435 Product size (bp): 267 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103341553 NCBI Gene Symbol: LOC103341553 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase subunit beta; mitochondrial Other designations: ATP synthase subunit beta; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 103341553 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (CCATCG)2 |
| Repeat start & end within CDS | Repeat start: 100 Repeat end: 111 |
| Forward primer | Primer sequence: CCGATCTCAAGCCCTAACCC Tm(°C): 59.893 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: AAGTGCAGTCAAGATCGGGG Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 66 End: 344 Product size (bp): 279 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103341553 NCBI Gene Symbol: LOC103341553 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase subunit beta; mitochondrial Other designations: ATP synthase subunit beta; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 103341553 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (GGGAA)2 |
| Repeat start & end within CDS | Repeat start: 223 Repeat end: 232 |
| Forward primer | Primer sequence: TAGAATCGCATCCCCATCGC Tm(°C): 60.037 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: AAGTGCAGTCAAGATCGGGG Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 86 End: 344 Product size (bp): 259 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103341553 NCBI Gene Symbol: LOC103341553 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase subunit beta; mitochondrial Other designations: ATP synthase subunit beta; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 103341553 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (GTGCTC)2 |
| Repeat start & end within CDS | Repeat start: 923 Repeat end: 934 |
| Forward primer | Primer sequence: GTTTGCCGGTGTTGGAGAAC Tm(°C): 59.97 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GGTATCCGACAGCAGATGGG Tm(°C): 59.966 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 782 End: 1086 Product size (bp): 305 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103341553 NCBI Gene Symbol: LOC103341553 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase subunit beta; mitochondrial Other designations: ATP synthase subunit beta; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 103341553 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (TGCTT)2 |
| Repeat start & end within CDS | Repeat start: 1050 Repeat end: 1059 |
| Forward primer | Primer sequence: GTTTGCCGGTGTTGGAGAAC Tm(°C): 59.97 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GGTATCCGACAGCAGATGGG Tm(°C): 59.966 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 782 End: 1086 Product size (bp): 305 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103341553 NCBI Gene Symbol: LOC103341553 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase subunit beta; mitochondrial Other designations: ATP synthase subunit beta; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 103341553 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (TGCCCG)2 |
| Repeat start & end within CDS | Repeat start: 1455 Repeat end: 1466 |
| Forward primer | Primer sequence: CTCACTTGGATGCCACCACT Tm(°C): 59.963 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TCCACGTATTTTCCAGGGGC Tm(°C): 60.035 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 1222 End: 1540 Product size (bp): 319 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103341553 NCBI Gene Symbol: LOC103341553 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase subunit beta; mitochondrial Other designations: ATP synthase subunit beta; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 103341553 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GTTTGCCGGTGTTGGAGAAC Tm(°C): 59.97 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CACCAGGGGGCTCATTCATT Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 782 End: 924 Product size (bp): 143 |
| JBrowse View | JBrowse |
