Statistics
Number of enzymes: 1
Total Number of designed primers: 7
Number of PGTM primers: 2
Number of PMTM primers: 5
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103324541 NCBI Gene Symbol: LOC103324541 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase gamma chain; chloroplastic Other designations: ATP synthase gamma chain; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: plus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 969288 ...... 970895 |
| CDS Sequence | 103324541 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (GT)5ggatgctgc(TGA)3gttcttcaggttgacaacaaa(GGAAG)2ttgact
gt(AG)4 |
| Repeat start & end within CDS | Repeat start: 767 Repeat end: 841 |
| Forward primer | Primer sequence: CCCAACTGCCAAAGAAGCAC Tm(°C): 59.967 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GCTCGAATTGCAAAACCGGT Tm(°C): 60.04 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 590 End: 891 Product size (bp): 302 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103324541 NCBI Gene Symbol: LOC103324541 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase gamma chain; chloroplastic Other designations: ATP synthase gamma chain; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: plus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 969288 ...... 970895 |
| CDS Sequence | 103324541 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (GAA)3 |
| Repeat start & end within CDS | Repeat start: 1035 Repeat end: 1043 |
| Forward primer | Primer sequence: ACTAGCCAGTGAGCTTGCTG Tm(°C): 60.037 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CTGCCTGTTGTAGACCCTGG Tm(°C): 60.036 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 968 End: 1067 Product size (bp): 100 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103324541 NCBI Gene Symbol: LOC103324541 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase gamma chain; chloroplastic Other designations: ATP synthase gamma chain; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: plus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 969288 ...... 970895 |
| CDS Sequence | 103324541 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TGAGCAGCTCCAAGTGGAAG Tm(°C): 59.964 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GTGCTTCTTTGGCAGTTGGG Tm(°C): 59.967 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 326 End: 609 Product size (bp): 284 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103326447 NCBI Gene Symbol: LOC103326447 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase gamma chain; chloroplastic-like Other designations: ATP synthase gamma chain; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: minus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 13920837 ...... 13922525 |
| CDS Sequence | 103326447 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (TTGGA)2 |
| Repeat start & end within CDS | Repeat start: 470 Repeat end: 479 |
| Forward primer | Primer sequence: AAGCAGTCATCAATGGCCGA Tm(°C): 60.035 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: ACCCTTTTTGCCGACACTGA Tm(°C): 60.107 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 247 End: 509 Product size (bp): 263 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103326447 NCBI Gene Symbol: LOC103326447 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase gamma chain; chloroplastic-like Other designations: ATP synthase gamma chain; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: minus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 13920837 ...... 13922525 |
| CDS Sequence | 103326447 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (CAA)3 |
| Repeat start & end within CDS | Repeat start: 575 Repeat end: 583 |
| Forward primer | Primer sequence: TCAGTGTCGGCAAAAAGGGT Tm(°C): 60.107 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: TCCACACTCAGTTTGCCTCC Tm(°C): 59.891 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 490 End: 817 Product size (bp): 328 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103326447 NCBI Gene Symbol: LOC103326447 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase gamma chain; chloroplastic-like Other designations: ATP synthase gamma chain; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: minus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 13920837 ...... 13922525 |
| CDS Sequence | 103326447 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (ATGGGA)2 |
| Repeat start & end within CDS | Repeat start: 740 Repeat end: 751 |
| Forward primer | Primer sequence: TCAGTGTCGGCAAAAAGGGT Tm(°C): 60.107 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: TCCACACTCAGTTTGCCTCC Tm(°C): 59.891 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 490 End: 817 Product size (bp): 328 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103326447 NCBI Gene Symbol: LOC103326447 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase gamma chain; chloroplastic-like Other designations: ATP synthase gamma chain; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: minus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 13920837 ...... 13922525 |
| CDS Sequence | 103326447 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: AGGGCTTTCACCGGTTATGG Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TTTAGTGCCTCAGCTCCAGC Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 845 End: 1108 Product size (bp): 264 |
| JBrowse View | JBrowse |
