Download Search Result

Enzyme Id:  K02114
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number:   18668037     NCBI Gene Symbol: atpE
Gene Aliases	CP95_p061
Gene description & Other designations	Description:   ATP synthase CF1 epsilon subunit      Other designations:
Chromosome, Strand & Exon count	Chromosome:        Strand:   minus     Exon count:   0
Gene Location within genomic sequence	Genomic accession No. NC_023798.1      Gene Start and end within genomic accession: 54150 ...... 54551
CDS Sequence	18668037
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Penta     Repeat sequence: (CGAAT)2
Repeat start & end within CDS	Repeat start: 29     Repeat end: 38
Forward primer	Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer	Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size	Start:      End:      Product size (bp):
JBrowse View	JBrowse

Enzyme Id:  K02114
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number:   18668037     NCBI Gene Symbol: atpE
Gene Aliases	CP95_p061
Gene description & Other designations	Description:   ATP synthase CF1 epsilon subunit      Other designations:
Chromosome, Strand & Exon count	Chromosome:        Strand:   minus     Exon count:   0
Gene Location within genomic sequence	Genomic accession No. NC_023798.1      Gene Start and end within genomic accession: 54150 ...... 54551
CDS Sequence	18668037
	Marker Information
Marker Type	PGTM
Repeat type & sequence	Repeat type:      Repeat sequence:
Repeat start & end within CDS	Repeat start:      Repeat end:
Forward primer	Primer sequence:   ACGCCTTAACGACCAATGGT     Tm(°C): 59.964     GC (%): 50     Size: 20
Reverse primer	Primer sequence:   ACTCGTGTCCTAGCTCGTCT     Tm(°C): 60.036     GC (%): 55     Size: 20
Primer start, end within sequence and product size	Start: 152     End: 376     Product size (bp): 225
JBrowse View	JBrowse