Statistics
Number of enzymes: 1
Total Number of designed primers: 6
Number of PGTM primers: 2
Number of PMTM primers: 4
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103332167 NCBI Gene Symbol: LOC103332167 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase delta chain; chloroplastic Other designations: ATP synthase delta chain; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: LG5 Strand: plus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_024130.1 Gene Start and end within genomic accession: 17614208 ...... 17615349 |
| CDS Sequence | 103332167 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (TCAAT)2cctcaaagtcccagaacacacaaacttcctccacaatcccaccttca
ct(CCA)3 |
| Repeat start & end within CDS | Repeat start: 78 Repeat end: 145 |
| Forward primer | Primer sequence: ACCCTCAAAGTCCCTACCCT Tm(°C): 59.503 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: AGAGAGGGTTGCAGAGGAGT Tm(°C): 59.884 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 27 End: 242 Product size (bp): 216 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103332167 NCBI Gene Symbol: LOC103332167 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase delta chain; chloroplastic Other designations: ATP synthase delta chain; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: LG5 Strand: plus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_024130.1 Gene Start and end within genomic accession: 17614208 ...... 17615349 |
| CDS Sequence | 103332167 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Di Repeat sequence: (CT)4 |
| Repeat start & end within CDS | Repeat start: 238 Repeat end: 245 |
| Forward primer | Primer sequence: CTCCACCACCAAACCCAACT Tm(°C): 60.106 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CACAAAAGGGTTGGCCAAGG Tm(°C): 59.893 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 134 End: 419 Product size (bp): 286 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103332167 NCBI Gene Symbol: LOC103332167 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase delta chain; chloroplastic Other designations: ATP synthase delta chain; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: LG5 Strand: plus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_024130.1 Gene Start and end within genomic accession: 17614208 ...... 17615349 |
| CDS Sequence | 103332167 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (CTGCT)2 |
| Repeat start & end within CDS | Repeat start: 299 Repeat end: 308 |
| Forward primer | Primer sequence: CTCCACCACCAAACCCAACT Tm(°C): 60.106 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CACAAAAGGGTTGGCCAAGG Tm(°C): 59.893 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 134 End: 419 Product size (bp): 286 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103332167 NCBI Gene Symbol: LOC103332167 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase delta chain; chloroplastic Other designations: ATP synthase delta chain; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: LG5 Strand: plus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_024130.1 Gene Start and end within genomic accession: 17614208 ...... 17615349 |
| CDS Sequence | 103332167 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: CTCCACCACCAAACCCAACT Tm(°C): 60.106 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CACAAAAGGGTTGGCCAAGG Tm(°C): 59.893 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 134 End: 419 Product size (bp): 286 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103336090 NCBI Gene Symbol: LOC103336090 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase delta chain; chloroplastic Other designations: ATP synthase delta chain; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: LG6 Strand: minus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 15871818 ...... 15873166 |
| CDS Sequence | 103336090 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (TCTCCT)3ccaccttcacccccatccccctcaagct(CTC)3 |
| Repeat start & end within CDS | Repeat start: 98 Repeat end: 152 |
| Forward primer | Primer sequence: CATCCCCACCACAACTCTCC Tm(°C): 60.035 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: GTTGGATTTGGCGACGTCTG Tm(°C): 59.834 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 49 End: 266 Product size (bp): 218 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103336090 NCBI Gene Symbol: LOC103336090 |
| Gene Aliases | |
| Gene description & Other designations | Description: ATP synthase delta chain; chloroplastic Other designations: ATP synthase delta chain; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: LG6 Strand: minus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 15871818 ...... 15873166 |
| CDS Sequence | 103336090 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: CATCCCCACCACAACTCTCC Tm(°C): 60.035 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: CCAGCTCTGTGTCCGTGATT Tm(°C): 60.037 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 49 End: 531 Product size (bp): 483 |
| JBrowse View | JBrowse |
