image


Statistics

Number of enzymes: 1
Total Number of designed primers: 6
Number of PGTM primers:     2
Number of PMTM primers:     4
Number of Failed designed PMTM primers: 1

Enzyme Id:  K02109

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   107880548     NCBI Gene Symbol: LOC107880548
Gene Aliases
Gene description & Other designations Description:   ATP synthase subunit b'; chloroplastic      Other designations:   ATP synthase subunit b'; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   1
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 6178258 ...... 6179388
CDS Sequence 107880548
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (CTTCCC)2
Repeat start & end within CDS Repeat start: 41     Repeat end: 52
Forward primer Primer sequence:   CATGATCATGGCCTCCTCCA     Tm(°C): 59.231     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ATAACGGAGAGGGACGACGA     Tm(°C): 60.108     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 8     End: 166     Product size (bp): 159
JBrowse View      JBrowse

Enzyme Id:  K02109

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   107880548     NCBI Gene Symbol: LOC107880548
Gene Aliases
Gene description & Other designations Description:   ATP synthase subunit b'; chloroplastic      Other designations:   ATP synthase subunit b'; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   1
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 6178258 ...... 6179388
CDS Sequence 107880548
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (CTTCGA)2
Repeat start & end within CDS Repeat start: 231     Repeat end: 242
Forward primer Primer sequence:   GTCCCTCTCCGTTATCGCAG     Tm(°C): 59.969     GC (%): 60     Size: 20
Reverse primer Primer sequence:   CTGCTTCACCTCCTCCGAAG     Tm(°C): 60.108     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 152     End: 398     Product size (bp): 247
JBrowse View      JBrowse

Enzyme Id:  K02109

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   107880548     NCBI Gene Symbol: LOC107880548
Gene Aliases
Gene description & Other designations Description:   ATP synthase subunit b'; chloroplastic      Other designations:   ATP synthase subunit b'; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   1
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 6178258 ...... 6179388
CDS Sequence 107880548
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (GA)4
Repeat start & end within CDS Repeat start: 334     Repeat end: 341
Forward primer Primer sequence:   GTCCCTCTCCGTTATCGCAG     Tm(°C): 59.969     GC (%): 60     Size: 20
Reverse primer Primer sequence:   CTGCTTCACCTCCTCCGAAG     Tm(°C): 60.108     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 152     End: 398     Product size (bp): 247
JBrowse View      JBrowse

Enzyme Id:  K02109

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   107880548     NCBI Gene Symbol: LOC107880548
Gene Aliases
Gene description & Other designations Description:   ATP synthase subunit b'; chloroplastic      Other designations:   ATP synthase subunit b'; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   1
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 6178258 ...... 6179388
CDS Sequence 107880548
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GGAGG)2
Repeat start & end within CDS Repeat start: 507     Repeat end: 516
Forward primer Primer sequence:   CTTCGGAGGAGGTGAAGCAG     Tm(°C): 60.108     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TCTCCTCCTTCTGCTCCTCC     Tm(°C): 60.033     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 379     End: 576     Product size (bp): 198
JBrowse View      JBrowse

Enzyme Id:  K02109

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   107880548     NCBI Gene Symbol: LOC107880548
Gene Aliases
Gene description & Other designations Description:   ATP synthase subunit b'; chloroplastic      Other designations:   ATP synthase subunit b'; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   1
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 6178258 ...... 6179388
CDS Sequence 107880548
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GTCCCTCTCCGTTATCGCAG     Tm(°C): 59.969     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TCTCCTCCTTCTGCTCCTCC     Tm(°C): 60.033     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 152     End: 576     Product size (bp): 425
JBrowse View      JBrowse

Enzyme Id:  K02109

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   18668003     NCBI Gene Symbol: atpF
Gene Aliases CP95_p081
Gene description & Other designations Description:   ATP synthase CF0 subunit I      Other designations:   
Chromosome, Strand & Exon count Chromosome:        Strand:   minus     Exon count:   0
Gene Location within genomic sequence Genomic accession No. NC_023798.1      Gene Start and end within genomic accession: 11648 ...... 12951
CDS Sequence 18668003
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CTTTC)2
Repeat start & end within CDS Repeat start: 20     Repeat end: 29
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K02109

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   18668003     NCBI Gene Symbol: atpF
Gene Aliases CP95_p081
Gene description & Other designations Description:   ATP synthase CF0 subunit I      Other designations:   
Chromosome, Strand & Exon count Chromosome:        Strand:   minus     Exon count:   0
Gene Location within genomic sequence Genomic accession No. NC_023798.1      Gene Start and end within genomic accession: 11648 ...... 12951
CDS Sequence 18668003
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GCGTAGTGCTTGGTGTGTTG     Tm(°C): 60.041     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GGCTTGCTGAAAAACCCGTT     Tm(°C): 59.896     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 103     End: 443     Product size (bp): 341
JBrowse View      JBrowse