Statistics
Number of enzymes: 1
Total Number of designed primers: 3
Number of PGTM primers: 1
Number of PMTM primers: 2
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 18668005 NCBI Gene Symbol: atpI |
| Gene Aliases | CP95_p079 |
| Gene description & Other designations | Description: ATP synthase CF0 subunit IV Other designations: |
| Chromosome, Strand & Exon count | Chromosome: Strand: minus Exon count: 0 |
| Gene Location within genomic sequence | Genomic accession No. NC_023798.1 Gene Start and end within genomic accession: 14849 ...... 15592 |
| CDS Sequence | 18668005 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (GCTTTA)2 |
| Repeat start & end within CDS | Repeat start: 415 Repeat end: 426 |
| Forward primer | Primer sequence: AGCCGCACCCACAAATGATA Tm(°C): 60.035 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: TCGCCTATATAAGCCGCAGC Tm(°C): 60.109 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 380 End: 721 Product size (bp): 342 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 18668005 NCBI Gene Symbol: atpI |
| Gene Aliases | CP95_p079 |
| Gene description & Other designations | Description: ATP synthase CF0 subunit IV Other designations: |
| Chromosome, Strand & Exon count | Chromosome: Strand: minus Exon count: 0 |
| Gene Location within genomic sequence | Genomic accession No. NC_023798.1 Gene Start and end within genomic accession: 14849 ...... 15592 |
| CDS Sequence | 18668005 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (GTT)3 |
| Repeat start & end within CDS | Repeat start: 601 Repeat end: 609 |
| Forward primer | Primer sequence: AGCCGCACCCACAAATGATA Tm(°C): 60.035 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: TCGCCTATATAAGCCGCAGC Tm(°C): 60.109 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 380 End: 721 Product size (bp): 342 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 18668005 NCBI Gene Symbol: atpI |
| Gene Aliases | CP95_p079 |
| Gene description & Other designations | Description: ATP synthase CF0 subunit IV Other designations: |
| Chromosome, Strand & Exon count | Chromosome: Strand: minus Exon count: 0 |
| Gene Location within genomic sequence | Genomic accession No. NC_023798.1 Gene Start and end within genomic accession: 14849 ...... 15592 |
| CDS Sequence | 18668005 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: AGCCGCACCCACAAATGATA Tm(°C): 60.035 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: TGACCTTCCATGGATTCGCC Tm(°C): 60.107 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 380 End: 736 Product size (bp): 357 |
| JBrowse View | JBrowse |
