image


Statistics

Number of enzymes: 1
Total Number of designed primers: 3
Number of PGTM primers:     1
Number of PMTM primers:     2
Number of Failed designed PMTM primers: 1

Enzyme Id:  K01913

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103323121     NCBI Gene Symbol: LOC103323121
Gene Aliases
Gene description & Other designations Description:   acetate/butyrate--CoA ligase AAE7; peroxisomal      Other designations:   acetate/butyrate--CoA ligase AAE7; peroxisomal
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 32239789 ...... 32243997
CDS Sequence 103323121
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AGCAA)2
Repeat start & end within CDS Repeat start: 419     Repeat end: 428
Forward primer Primer sequence:   CGATGGCAGGAGCTGTGTTA     Tm(°C): 60.108     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TTTTAGTGCCCCGGGATCAC     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 271     End: 494     Product size (bp): 224
JBrowse View      JBrowse

Enzyme Id:  K01913

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103323121     NCBI Gene Symbol: LOC103323121
Gene Aliases
Gene description & Other designations Description:   acetate/butyrate--CoA ligase AAE7; peroxisomal      Other designations:   acetate/butyrate--CoA ligase AAE7; peroxisomal
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 32239789 ...... 32243997
CDS Sequence 103323121
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (GGCCAA)2
Repeat start & end within CDS Repeat start: 1659     Repeat end: 1670
Forward primer Primer sequence:   CACCCGGCCATATTTGAGGT     Tm(°C): 60.107     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCATGTTGAGAGGTCCCAGC     Tm(°C): 59.385     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1422     End: 1692     Product size (bp): 271
JBrowse View      JBrowse

Enzyme Id:  K01913

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103323121     NCBI Gene Symbol: LOC103323121
Gene Aliases
Gene description & Other designations Description:   acetate/butyrate--CoA ligase AAE7; peroxisomal      Other designations:   acetate/butyrate--CoA ligase AAE7; peroxisomal
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 32239789 ...... 32243997
CDS Sequence 103323121
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TGG)3
Repeat start & end within CDS Repeat start: 2     Repeat end: 10
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K01913

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103323121     NCBI Gene Symbol: LOC103323121
Gene Aliases
Gene description & Other designations Description:   acetate/butyrate--CoA ligase AAE7; peroxisomal      Other designations:   acetate/butyrate--CoA ligase AAE7; peroxisomal
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 32239789 ...... 32243997
CDS Sequence 103323121
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GGTGGAGCGAGACATAGACG     Tm(°C): 59.97     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TTTTAGTGCCCCGGGATCAC     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 5     End: 494     Product size (bp): 490
JBrowse View      JBrowse