Enzyme Id: K01835 |
||
| Gene Information | ||
| NCBI Gene Accession Number & Symbol | Accession Number: AT1G23190 NCBI Gene Symbol: PGM3 | |
| Gene Aliases | AT1G23190; T26J12.5; T26J12_5; phosphoglucomutase 3 | |
| Gene description & Other designations | Description: Phosphoglucomutase/phosphomannomutase family protein Other designations: Phosphoglucomutase/phosphomannomutase family protein | |
| Chromosome, Strand & Exon count | Chromosome: 1 Strand: plus Exon count: 18 | |
| Gene Location within genomic sequence | Genomic accession No. NC_003070.9 Gene Start and end within genomic accession: 8219808 ...... 8224547 | |
| CDS Sequence | AT1G23190 | |
| Marker Information | ||
| Marker Type | PMTM | |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (TGCAT)2 | |
| Repeat start & end within CDS | Repeat start: 681 Repeat end: 690 | |
| Forward primer | Primer sequence: CAATCCTGGTGGCCCTACTG Tm(°C): 60.107 GC (%): 60 Size: 20 | |
| Reverse primer | Primer sequence: TGCATAGGCTCCAGCAACTC Tm(°C): 60.108 GC (%): 55 Size: 20 | |
| Primer start, end within sequence and product size | Start: 371 End: 710 Product size (bp): 340 | |
| JBrowse View | JBrowse | |
Enzyme Id: K01835 |
||
| Gene Information | ||
| NCBI Gene Accession Number & Symbol | Accession Number: AT1G23190 NCBI Gene Symbol: PGM3 | |
| Gene Aliases | AT1G23190; T26J12.5; T26J12_5; phosphoglucomutase 3 | |
| Gene description & Other designations | Description: Phosphoglucomutase/phosphomannomutase family protein Other designations: Phosphoglucomutase/phosphomannomutase family protein | |
| Chromosome, Strand & Exon count | Chromosome: 1 Strand: plus Exon count: 18 | |
| Gene Location within genomic sequence | Genomic accession No. NC_003070.9 Gene Start and end within genomic accession: 8219808 ...... 8224547 | |
| CDS Sequence | AT1G23190 | |
| Marker Information | ||
| Marker Type | PMTM | |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (CATAA)2 | |
| Repeat start & end within CDS | Repeat start: 1743 Repeat end: 1752 | |
| Forward primer | Primer sequence: None Tm(°C): GC (%): Size: | |
| Reverse primer | Primer sequence: None Tm(°C): GC (%): Size: | |
| Primer start, end within sequence and product size | Start: End: Product size (bp): | |
| JBrowse View | JBrowse | |
Enzyme Id: K01835 |
||
| Gene Information | ||
| NCBI Gene Accession Number & Symbol | Accession Number: AT1G23190 NCBI Gene Symbol: PGM3 | |
| Gene Aliases | AT1G23190; T26J12.5; T26J12_5; phosphoglucomutase 3 | |
| Gene description & Other designations | Description: Phosphoglucomutase/phosphomannomutase family protein Other designations: Phosphoglucomutase/phosphomannomutase family protein | |
| Chromosome, Strand & Exon count | Chromosome: 1 Strand: plus Exon count: 18 | |
| Gene Location within genomic sequence | Genomic accession No. NC_003070.9 Gene Start and end within genomic accession: 8219808 ...... 8224547 | |
| CDS Sequence | AT1G23190 | |
| Marker Information | ||
| Marker Type | PGTM | |
| Repeat type & sequence | Repeat type: Repeat sequence: | |
| Repeat start & end within CDS | Repeat start: Repeat end: | |
| Forward primer | Primer sequence: CGCCAGTGCTGATGAATTCG Tm(°C): 59.973 GC (%): 55 Size: 20 | |
| Reverse primer | Primer sequence: CGGCCTGTGAACTCTTCCAT Tm(°C): 60.036 GC (%): 55 Size: 20 | |
| Primer start, end within sequence and product size | Start: 1466 End: 1726 Product size (bp): 261 | |
| JBrowse View | JBrowse | |
Enzyme Id: K01835 |
||
| Gene Information | ||
| NCBI Gene Accession Number & Symbol | Accession Number: AT1G70730 NCBI Gene Symbol: PGM2 | |
| Gene Aliases | AT1G70730; F5A18.9; F5A18_9; phosphoglucomutase 2 | |
| Gene description & Other designations | Description: Phosphoglucomutase/phosphomannomutase family protein Other designations: Phosphoglucomutase/phosphomannomutase family protein | |
| Chromosome, Strand & Exon count | Chromosome: 1 Strand: minus Exon count: 19 | |
| Gene Location within genomic sequence | Genomic accession No. NC_003070.9 Gene Start and end within genomic accession: 26668646 ...... 26673166 | |
| CDS Sequence | AT1G70730 | |
| Marker Information | ||
| Marker Type | PMTM | |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (TGCAT)2 | |
| Repeat start & end within CDS | Repeat start: 684 Repeat end: 693 | |
| Forward primer | Primer sequence: GCCCAACTGAGGATTTCGGA Tm(°C): 60.035 GC (%): 55 Size: 20 | |
| Reverse primer | Primer sequence: TGCATATGCTCCAGCCACTC Tm(°C): 60.179 GC (%): 55 Size: 20 | |
| Primer start, end within sequence and product size | Start: 385 End: 713 Product size (bp): 329 | |
| JBrowse View | JBrowse | |
Enzyme Id: K01835 |
||
| Gene Information | ||
| NCBI Gene Accession Number & Symbol | Accession Number: AT1G70730 NCBI Gene Symbol: PGM2 | |
| Gene Aliases | AT1G70730; F5A18.9; F5A18_9; phosphoglucomutase 2 | |
| Gene description & Other designations | Description: Phosphoglucomutase/phosphomannomutase family protein Other designations: Phosphoglucomutase/phosphomannomutase family protein | |
| Chromosome, Strand & Exon count | Chromosome: 1 Strand: minus Exon count: 19 | |
| Gene Location within genomic sequence | Genomic accession No. NC_003070.9 Gene Start and end within genomic accession: 26668646 ...... 26673166 | |
| CDS Sequence | AT1G70730 | |
| Marker Information | ||
| Marker Type | PMTM | |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (CCATA)2 | |
| Repeat start & end within CDS | Repeat start: 995 Repeat end: 1004 | |
| Forward primer | Primer sequence: TGGTGATGCAGACCGAAACA Tm(°C): 59.892 GC (%): 50 Size: 20 | |
| Reverse primer | Primer sequence: ACGACATCAAGTGCAGCTGA Tm(°C): 59.966 GC (%): 50 Size: 20 | |
| Primer start, end within sequence and product size | Start: 902 End: 1066 Product size (bp): 165 | |
| JBrowse View | JBrowse | |
Enzyme Id: K01835 |
||
| Gene Information | ||
| NCBI Gene Accession Number & Symbol | Accession Number: AT1G70730 NCBI Gene Symbol: PGM2 | |
| Gene Aliases | AT1G70730; F5A18.9; F5A18_9; phosphoglucomutase 2 | |
| Gene description & Other designations | Description: Phosphoglucomutase/phosphomannomutase family protein Other designations: Phosphoglucomutase/phosphomannomutase family protein | |
| Chromosome, Strand & Exon count | Chromosome: 1 Strand: minus Exon count: 19 | |
| Gene Location within genomic sequence | Genomic accession No. NC_003070.9 Gene Start and end within genomic accession: 26668646 ...... 26673166 | |
| CDS Sequence | AT1G70730 | |
| Marker Information | ||
| Marker Type | PMTM | |
| Repeat type & sequence | Repeat type: Di Repeat sequence: (TC)4 | |
| Repeat start & end within CDS | Repeat start: 17 Repeat end: 24 | |
| Forward primer | Primer sequence: None Tm(°C): GC (%): Size: | |
| Reverse primer | Primer sequence: None Tm(°C): GC (%): Size: | |
| Primer start, end within sequence and product size | Start: End: Product size (bp): | |
| JBrowse View | JBrowse | |
Enzyme Id: K01835 |
||
| Gene Information | ||
| NCBI Gene Accession Number & Symbol | Accession Number: AT1G70730 NCBI Gene Symbol: PGM2 | |
| Gene Aliases | AT1G70730; F5A18.9; F5A18_9; phosphoglucomutase 2 | |
| Gene description & Other designations | Description: Phosphoglucomutase/phosphomannomutase family protein Other designations: Phosphoglucomutase/phosphomannomutase family protein | |
| Chromosome, Strand & Exon count | Chromosome: 1 Strand: minus Exon count: 19 | |
| Gene Location within genomic sequence | Genomic accession No. NC_003070.9 Gene Start and end within genomic accession: 26668646 ...... 26673166 | |
| CDS Sequence | AT1G70730 | |
| Marker Information | ||
| Marker Type | PGTM | |
| Repeat type & sequence | Repeat type: Repeat sequence: | |
| Repeat start & end within CDS | Repeat start: Repeat end: | |
| Forward primer | Primer sequence: GGTGCGACACTTGTGGTTTC Tm(°C): 59.971 GC (%): 55 Size: 20 | |
| Reverse primer | Primer sequence: TCCGAAATCCTCAGTTGGGC Tm(°C): 60.035 GC (%): 55 Size: 20 | |
| Primer start, end within sequence and product size | Start: 162 End: 404 Product size (bp): 243 | |
| JBrowse View | JBrowse | |
Enzyme Id: K01835 |
||
| Gene Information | ||
| NCBI Gene Accession Number & Symbol | Accession Number: AT5G51820 NCBI Gene Symbol: PGM | |
| Gene Aliases | AT5G51820; ARABIDOPSIS THALIANA PHOSPHOGLUCOMUTASE; ATPGMP; MIO24.4; MIO24_4; PGM1; PHOSPHOGLUCOMUTASE; STARCH-FREE 1; STF1; phosphoglucomutase | |
| Gene description & Other designations | Description: phosphoglucomutase Other designations: phosphoglucomutase | |
| Chromosome, Strand & Exon count | Chromosome: 5 Strand: minus Exon count: 22 | |
| Gene Location within genomic sequence | Genomic accession No. NC_003076.8 Gene Start and end within genomic accession: 21063298 ...... 21068327 | |
| CDS Sequence | AT5G51820 | |
| Marker Information | ||
| Marker Type | PMTM | |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (TCATCT)2 | |
| Repeat start & end within CDS | Repeat start: 166 Repeat end: 177 | |
| Forward primer | Primer sequence: ATTGCCGTCTCCGTCGTTTA Tm(°C): 59.756 GC (%): 50 Size: 20 | |
| Reverse primer | Primer sequence: CTTCCGGAGTCCGCTAGTTC Tm(°C): 59.899 GC (%): 60 Size: 20 | |
| Primer start, end within sequence and product size | Start: 74 End: 266 Product size (bp): 193 | |
| JBrowse View | JBrowse | |
Enzyme Id: K01835 |
||
| Gene Information | ||
| NCBI Gene Accession Number & Symbol | Accession Number: AT5G51820 NCBI Gene Symbol: PGM | |
| Gene Aliases | AT5G51820; ARABIDOPSIS THALIANA PHOSPHOGLUCOMUTASE; ATPGMP; MIO24.4; MIO24_4; PGM1; PHOSPHOGLUCOMUTASE; STARCH-FREE 1; STF1; phosphoglucomutase | |
| Gene description & Other designations | Description: phosphoglucomutase Other designations: phosphoglucomutase | |
| Chromosome, Strand & Exon count | Chromosome: 5 Strand: minus Exon count: 22 | |
| Gene Location within genomic sequence | Genomic accession No. NC_003076.8 Gene Start and end within genomic accession: 21063298 ...... 21068327 | |
| CDS Sequence | AT5G51820 | |
| Marker Information | ||
| Marker Type | PMTM | |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (GTGATG)2 | |
| Repeat start & end within CDS | Repeat start: 1034 Repeat end: 1045 | |
| Forward primer | Primer sequence: TCCCCTGGAAGATTTTGGGC Tm(°C): 59.959 GC (%): 55 Size: 20 | |
| Reverse primer | Primer sequence: TCAACTTCTCGGCAACACGA Tm(°C): 59.897 GC (%): 50 Size: 20 | |
| Primer start, end within sequence and product size | Start: 926 End: 1215 Product size (bp): 290 | |
| JBrowse View | JBrowse | |
Enzyme Id: K01835 |
||
| Gene Information | ||
| NCBI Gene Accession Number & Symbol | Accession Number: AT5G51820 NCBI Gene Symbol: PGM | |
| Gene Aliases | AT5G51820; ARABIDOPSIS THALIANA PHOSPHOGLUCOMUTASE; ATPGMP; MIO24.4; MIO24_4; PGM1; PHOSPHOGLUCOMUTASE; STARCH-FREE 1; STF1; phosphoglucomutase | |
| Gene description & Other designations | Description: phosphoglucomutase Other designations: phosphoglucomutase | |
| Chromosome, Strand & Exon count | Chromosome: 5 Strand: minus Exon count: 22 | |
| Gene Location within genomic sequence | Genomic accession No. NC_003076.8 Gene Start and end within genomic accession: 21063298 ...... 21068327 | |
| CDS Sequence | AT5G51820 | |
| Marker Information | ||
| Marker Type | PGTM | |
| Repeat type & sequence | Repeat type: Repeat sequence: | |
| Repeat start & end within CDS | Repeat start: Repeat end: | |
| Forward primer | Primer sequence: TCATCGCAACAAGGACACGA Tm(°C): 59.967 GC (%): 50 Size: 20 | |
| Reverse primer | Primer sequence: CCGGCCTTGCTCTTAGACAA Tm(°C): 60.036 GC (%): 55 Size: 20 | |
| Primer start, end within sequence and product size | Start: 1379 End: 1561 Product size (bp): 183 | |
| JBrowse View | JBrowse | |