Statistics
Number of enzymes: 1
Total Number of designed primers: 4
Number of PGTM primers: 1
Number of PMTM primers: 3
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103337840 NCBI Gene Symbol: LOC103337840 |
| Gene Aliases | |
| Gene description & Other designations | Description: methionine gamma-lyase Other designations: methionine gamma-lyase |
| Chromosome, Strand & Exon count | Chromosome: LG7 Strand: plus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_024132.1 Gene Start and end within genomic accession: 11254705 ...... 11257325 |
| CDS Sequence | 103337840 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (AGAGC)2gcgatgacatggacaacgacgactacgtggccgccaaaaagtcca(T
GT)3cctcagct(GCGGCC)2 |
| Repeat start & end within CDS | Repeat start: 61 Repeat end: 144 |
| Forward primer | Primer sequence: AACAACGCCACCTCCAAGAA Tm(°C): 60.107 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: TTGAGCACCGTCGGATTGAA Tm(°C): 59.966 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 39 End: 340 Product size (bp): 302 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103337840 NCBI Gene Symbol: LOC103337840 |
| Gene Aliases | |
| Gene description & Other designations | Description: methionine gamma-lyase Other designations: methionine gamma-lyase |
| Chromosome, Strand & Exon count | Chromosome: LG7 Strand: plus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_024132.1 Gene Start and end within genomic accession: 11254705 ...... 11257325 |
| CDS Sequence | 103337840 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (ACG)3 |
| Repeat start & end within CDS | Repeat start: 529 Repeat end: 537 |
| Forward primer | Primer sequence: TTCAATCCGACGGTGCTCAA Tm(°C): 59.966 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: CTCGATCGCATTCCTCACCA Tm(°C): 59.897 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 321 End: 581 Product size (bp): 261 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103337840 NCBI Gene Symbol: LOC103337840 |
| Gene Aliases | |
| Gene description & Other designations | Description: methionine gamma-lyase Other designations: methionine gamma-lyase |
| Chromosome, Strand & Exon count | Chromosome: LG7 Strand: plus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_024132.1 Gene Start and end within genomic accession: 11254705 ...... 11257325 |
| CDS Sequence | 103337840 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (GGTGT)2 |
| Repeat start & end within CDS | Repeat start: 802 Repeat end: 811 |
| Forward primer | Primer sequence: GTTTATTAGCGGCGGTGCTG Tm(°C): 59.972 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CCATGGACTTGAGCAGCTCA Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 770 End: 1056 Product size (bp): 287 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103337840 NCBI Gene Symbol: LOC103337840 |
| Gene Aliases | |
| Gene description & Other designations | Description: methionine gamma-lyase Other designations: methionine gamma-lyase |
| Chromosome, Strand & Exon count | Chromosome: LG7 Strand: plus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_024132.1 Gene Start and end within genomic accession: 11254705 ...... 11257325 |
| CDS Sequence | 103337840 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GTTTATTAGCGGCGGTGCTG Tm(°C): 59.972 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CCGAACTGGGTGCAGTTTTG Tm(°C): 59.969 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 770 End: 1159 Product size (bp): 390 |
| JBrowse View | JBrowse |
