|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103339313 NCBI Gene Symbol: LOC103339313 |
| Gene Aliases | |
| Gene description & Other designations | Description: cystathionine beta-lyase; chloroplastic Other designations: cystathionine beta-lyase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: LG8 Strand: plus Exon count: 13 |
| Gene Location within genomic sequence | Genomic accession No. NC_024133.1 Gene Start and end within genomic accession: 5415636 ...... 5422317 |
| CDS Sequence | 103339313 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (CCTGC)2 |
| Repeat start & end within CDS | Repeat start: 1269 Repeat end: 1278 |
| Forward primer | Primer sequence: CCCATCCACGAGTGACACAA Tm(°C): 59.965 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GCAGATGGTATGCTTGCGTG Tm(°C): 59.971 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 1069 End: 1306 Product size (bp): 238 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103339313 NCBI Gene Symbol: LOC103339313 |
| Gene Aliases | |
| Gene description & Other designations | Description: cystathionine beta-lyase; chloroplastic Other designations: cystathionine beta-lyase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: LG8 Strand: plus Exon count: 13 |
| Gene Location within genomic sequence | Genomic accession No. NC_024133.1 Gene Start and end within genomic accession: 5415636 ...... 5422317 |
| CDS Sequence | 103339313 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (CTT)3(TC)4* |
| Repeat start & end within CDS | Repeat start: 8 Repeat end: 23 |
| Forward primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Reverse primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Primer start, end within sequence and product size | Start: End: Product size (bp): |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103339313 NCBI Gene Symbol: LOC103339313 |
| Gene Aliases | |
| Gene description & Other designations | Description: cystathionine beta-lyase; chloroplastic Other designations: cystathionine beta-lyase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: LG8 Strand: plus Exon count: 13 |
| Gene Location within genomic sequence | Genomic accession No. NC_024133.1 Gene Start and end within genomic accession: 5415636 ...... 5422317 |
| CDS Sequence | 103339313 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: AGCCACTGGATCTAGGAGCA Tm(°C): 60.032 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GCAGATGGTATGCTTGCGTG Tm(°C): 59.971 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 814 End: 1306 Product size (bp): 493 |
| JBrowse View | JBrowse |
