image


Statistics

Number of enzymes: 1
Total Number of designed primers: 19
Number of PGTM primers:     7
Number of PMTM primers:     12
Number of Failed designed PMTM primers: 1

Enzyme Id:  K01759
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103340876     NCBI Gene Symbol: LOC103340876
Gene Aliases
Gene description & Other designations Description:   probable lactoylglutathione lyase; chloroplastic      Other designations:   probable lactoylglutathione lyase; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   plus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 14803776 ...... 14807121
CDS Sequence 103340876
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (CACAGT)2
Repeat start & end within CDS Repeat start: 143     Repeat end: 154
Forward primer Primer sequence:   GGCCTTTCTCTCGCTTCCTT     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGGTATGTCACGTTTCCGCA     Tm(°C): 59.966     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 78     End: 392     Product size (bp): 315
JBrowse View      JBrowse

Enzyme Id:  K01759
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103340876     NCBI Gene Symbol: LOC103340876
Gene Aliases
Gene description & Other designations Description:   probable lactoylglutathione lyase; chloroplastic      Other designations:   probable lactoylglutathione lyase; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   plus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 14803776 ...... 14807121
CDS Sequence 103340876
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GGCCTTTCTCTCGCTTCCTT     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGGTATGTCACGTTTCCGCA     Tm(°C): 59.966     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 78     End: 392     Product size (bp): 315
JBrowse View      JBrowse

Enzyme Id:  K01759
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320204     NCBI Gene Symbol: LOC103320204
Gene Aliases
Gene description & Other designations Description:   probable lactoylglutathione lyase; chloroplastic      Other designations:   probable lactoylglutathione lyase; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 9440248 ...... 9443817
CDS Sequence 103320204
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TGTGA)2
Repeat start & end within CDS Repeat start: 73     Repeat end: 82
Forward primer Primer sequence:   CCTTCTCTTGCTCCACCACC     Tm(°C): 60.322     GC (%): 60     Size: 20
Reverse primer Primer sequence:   GGTGAAAGAGAGCGAGCCTT     Tm(°C): 60.037     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 36     End: 132     Product size (bp): 97
JBrowse View      JBrowse

Enzyme Id:  K01759
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320204     NCBI Gene Symbol: LOC103320204
Gene Aliases
Gene description & Other designations Description:   probable lactoylglutathione lyase; chloroplastic      Other designations:   probable lactoylglutathione lyase; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 9440248 ...... 9443817
CDS Sequence 103320204
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (GCTCT)2acctcagtcacaactattagttgcaaaagcatctgagttgctaagag
(GA)4
Repeat start & end within CDS Repeat start: 137     Repeat end: 201
Forward primer Primer sequence:   AAGGCTCGCTCTCTTTCACC     Tm(°C): 60.037     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CTCCTCTGGTATGTCACGCC     Tm(°C): 59.897     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 113     End: 404     Product size (bp): 292
JBrowse View      JBrowse

Enzyme Id:  K01759
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320204     NCBI Gene Symbol: LOC103320204
Gene Aliases
Gene description & Other designations Description:   probable lactoylglutathione lyase; chloroplastic      Other designations:   probable lactoylglutathione lyase; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 9440248 ...... 9443817
CDS Sequence 103320204
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TTG)3
Repeat start & end within CDS Repeat start: 452     Repeat end: 460
Forward primer Primer sequence:   GGCGTGACATACCAGAGGAG     Tm(°C): 59.897     GC (%): 60     Size: 20
Reverse primer Primer sequence:   AAGGCCCTCTCTCCAAAAGC     Tm(°C): 59.961     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 385     End: 678     Product size (bp): 294
JBrowse View      JBrowse

Enzyme Id:  K01759
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320204     NCBI Gene Symbol: LOC103320204
Gene Aliases
Gene description & Other designations Description:   probable lactoylglutathione lyase; chloroplastic      Other designations:   probable lactoylglutathione lyase; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 9440248 ...... 9443817
CDS Sequence 103320204
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   AAGGCTCGCTCTCTTTCACC     Tm(°C): 60.037     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GGGCAGCCTCTAGTGTGTTT     Tm(°C): 59.963     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 113     End: 219     Product size (bp): 107
JBrowse View      JBrowse

Enzyme Id:  K01759
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103325935     NCBI Gene Symbol: LOC103325935
Gene Aliases
Gene description & Other designations Description:   lactoylglutathione lyase      Other designations:   lactoylglutathione lyase
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 7152440 ...... 7157231
CDS Sequence 103325935
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (CA)4
Repeat start & end within CDS Repeat start: 83     Repeat end: 90
Forward primer Primer sequence:   CTGCTTCAATCACAACCGCC     Tm(°C): 60.11     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGTCCAGCCTCTTAAGCAGC     Tm(°C): 59.748     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 10     End: 321     Product size (bp): 312
JBrowse View      JBrowse

Enzyme Id:  K01759
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103325935     NCBI Gene Symbol: LOC103325935
Gene Aliases
Gene description & Other designations Description:   lactoylglutathione lyase      Other designations:   lactoylglutathione lyase
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 7152440 ...... 7157231
CDS Sequence 103325935
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AGTTT)2
Repeat start & end within CDS Repeat start: 335     Repeat end: 344
Forward primer Primer sequence:   CGTCGTTTCCACACACAACC     Tm(°C): 59.973     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGGCCAAAGGTCCAAACTGT     Tm(°C): 60.033     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 73     End: 418     Product size (bp): 346
JBrowse View      JBrowse

Enzyme Id:  K01759
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103325935     NCBI Gene Symbol: LOC103325935
Gene Aliases
Gene description & Other designations Description:   lactoylglutathione lyase      Other designations:   lactoylglutathione lyase
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 7152440 ...... 7157231
CDS Sequence 103325935
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CGTCGTTTCCACACACAACC     Tm(°C): 59.973     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGGCCAAAGGTCCAAACTGT     Tm(°C): 60.033     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 73     End: 418     Product size (bp): 346
JBrowse View      JBrowse

Enzyme Id:  K01759
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103326435     NCBI Gene Symbol: LOC103326435
Gene Aliases
Gene description & Other designations Description:   putative lactoylglutathione lyase      Other designations:   putative lactoylglutathione lyase
Chromosome, Strand & Exon count Chromosome:   LG3     Strand:   plus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024128.1      Gene Start and end within genomic accession: 13811511 ...... 13816242
CDS Sequence 103326435
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CTA)3
Repeat start & end within CDS Repeat start: 535     Repeat end: 543
Forward primer Primer sequence:   CGTGAAGGATCCCAATGGCT     Tm(°C): 60.107     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGCGCTCTTGTACACGTCAT     Tm(°C): 60.039     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 398     End: 716     Product size (bp): 319
JBrowse View      JBrowse

Enzyme Id:  K01759
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103326435     NCBI Gene Symbol: LOC103326435
Gene Aliases
Gene description & Other designations Description:   putative lactoylglutathione lyase      Other designations:   putative lactoylglutathione lyase
Chromosome, Strand & Exon count Chromosome:   LG3     Strand:   plus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024128.1      Gene Start and end within genomic accession: 13811511 ...... 13816242
CDS Sequence 103326435
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CGTGAAGGATCCCAATGGCT     Tm(°C): 60.107     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGCGCTCTTGTACACGTCAT     Tm(°C): 60.039     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 398     End: 716     Product size (bp): 319
JBrowse View      JBrowse

Enzyme Id:  K01759
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103326436     NCBI Gene Symbol: LOC103326436
Gene Aliases
Gene description & Other designations Description:   lactoylglutathione lyase-like      Other designations:   lactoylglutathione lyase-like
Chromosome, Strand & Exon count Chromosome:   LG3     Strand:   plus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024128.1      Gene Start and end within genomic accession: 13831086 ...... 13833275
CDS Sequence 103326436
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CAATG)2
Repeat start & end within CDS Repeat start: 309     Repeat end: 318
Forward primer Primer sequence:   GCAGTTGTTGGGTTTGGACC     Tm(°C): 59.896     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGATGGTAGTCCCGCCTTCT     Tm(°C): 60.032     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 249     End: 459     Product size (bp): 211
JBrowse View      JBrowse

Enzyme Id:  K01759
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103326436     NCBI Gene Symbol: LOC103326436
Gene Aliases
Gene description & Other designations Description:   lactoylglutathione lyase-like      Other designations:   lactoylglutathione lyase-like
Chromosome, Strand & Exon count Chromosome:   LG3     Strand:   plus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024128.1      Gene Start and end within genomic accession: 13831086 ...... 13833275
CDS Sequence 103326436
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CTA)3
Repeat start & end within CDS Repeat start: 604     Repeat end: 612
Forward primer Primer sequence:   AGAAGGCGGGACTACCATCT     Tm(°C): 60.032     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGCGCTCTTGTACACGTCAT     Tm(°C): 60.039     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 440     End: 785     Product size (bp): 346
JBrowse View      JBrowse

Enzyme Id:  K01759
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103326436     NCBI Gene Symbol: LOC103326436
Gene Aliases
Gene description & Other designations Description:   lactoylglutathione lyase-like      Other designations:   lactoylglutathione lyase-like
Chromosome, Strand & Exon count Chromosome:   LG3     Strand:   plus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024128.1      Gene Start and end within genomic accession: 13831086 ...... 13833275
CDS Sequence 103326436
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (AAAACC)2
Repeat start & end within CDS Repeat start: 853     Repeat end: 864
Forward primer Primer sequence:   ATGACGTGTACAAGAGCGCA     Tm(°C): 60.039     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TGTCCACCAACACCGTTTGA     Tm(°C): 60.035     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 766     End: 915     Product size (bp): 150
JBrowse View      JBrowse

Enzyme Id:  K01759
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103326436     NCBI Gene Symbol: LOC103326436
Gene Aliases
Gene description & Other designations Description:   lactoylglutathione lyase-like      Other designations:   lactoylglutathione lyase-like
Chromosome, Strand & Exon count Chromosome:   LG3     Strand:   plus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024128.1      Gene Start and end within genomic accession: 13831086 ...... 13833275
CDS Sequence 103326436
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CACATGCCACCACAATGCAA     Tm(°C): 59.966     GC (%): 50     Size: 20
Reverse primer Primer sequence:   AGATGGTAGTCCCGCCTTCT     Tm(°C): 60.032     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 296     End: 459     Product size (bp): 164
JBrowse View      JBrowse

Enzyme Id:  K01759
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103326437     NCBI Gene Symbol: LOC103326437
Gene Aliases
Gene description & Other designations Description:   putative lactoylglutathione lyase      Other designations:   putative lactoylglutathione lyase
Chromosome, Strand & Exon count Chromosome:   LG3     Strand:   plus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024128.1      Gene Start and end within genomic accession: 13842938 ...... 13846327
CDS Sequence 103326437
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CAATG)2
Repeat start & end within CDS Repeat start: 279     Repeat end: 288
Forward primer Primer sequence:   GCAGTTGTTGGGTTTGGACC     Tm(°C): 59.896     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ATCGAAGGCTGTTCCAACGT     Tm(°C): 59.965     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 219     End: 317     Product size (bp): 99
JBrowse View      JBrowse

Enzyme Id:  K01759
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103326437     NCBI Gene Symbol: LOC103326437
Gene Aliases
Gene description & Other designations Description:   putative lactoylglutathione lyase      Other designations:   putative lactoylglutathione lyase
Chromosome, Strand & Exon count Chromosome:   LG3     Strand:   plus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024128.1      Gene Start and end within genomic accession: 13842938 ...... 13846327
CDS Sequence 103326437
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (AAAACC)2
Repeat start & end within CDS Repeat start: 823     Repeat end: 834
Forward primer Primer sequence:   ATGACGTGTACAAGAGCGCA     Tm(°C): 60.039     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TGTCCACCAACACCGTTTGA     Tm(°C): 60.035     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 736     End: 885     Product size (bp): 150
JBrowse View      JBrowse

Enzyme Id:  K01759
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103326437     NCBI Gene Symbol: LOC103326437
Gene Aliases
Gene description & Other designations Description:   putative lactoylglutathione lyase      Other designations:   putative lactoylglutathione lyase
Chromosome, Strand & Exon count Chromosome:   LG3     Strand:   plus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024128.1      Gene Start and end within genomic accession: 13842938 ...... 13846327
CDS Sequence 103326437
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   ACGTTGGAACAGCCTTCGAT     Tm(°C): 59.965     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TGCGCTCTTGTACACGTCAT     Tm(°C): 60.039     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 298     End: 755     Product size (bp): 458
JBrowse View      JBrowse

Enzyme Id:  K01759
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103324548     NCBI Gene Symbol: LOC103324548
Gene Aliases
Gene description & Other designations Description:   putative lactoylglutathione lyase      Other designations:   putative lactoylglutathione lyase
Chromosome, Strand & Exon count Chromosome:   LG3     Strand:   minus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_024128.1      Gene Start and end within genomic accession: 1033673 ...... 1036203
CDS Sequence 103324548
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (GAGGCA)2
Repeat start & end within CDS Repeat start: 7     Repeat end: 18
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K01759
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103324548     NCBI Gene Symbol: LOC103324548
Gene Aliases
Gene description & Other designations Description:   putative lactoylglutathione lyase      Other designations:   putative lactoylglutathione lyase
Chromosome, Strand & Exon count Chromosome:   LG3     Strand:   minus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_024128.1      Gene Start and end within genomic accession: 1033673 ...... 1036203
CDS Sequence 103324548
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TTGAAAAGGTTCGCGCCAAG     Tm(°C): 59.97     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TTCAAGATCACCAACGCGGA     Tm(°C): 59.966     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 325     End: 500     Product size (bp): 176
JBrowse View      JBrowse