Statistics
Number of enzymes: 1
Total Number of designed primers: 2
Number of PGTM primers: 1
Number of PMTM primers: 1
Number of Failed designed PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 108219287 NCBI Gene Symbol: LOC108219287 |
| Gene Aliases | DCAR_013737 |
| Gene description & Other designations | Description: porphobilinogen deaminase; chloroplastic Other designations: porphobilinogen deaminase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 4 Strand: minus Exon count: 6 |
| Gene Location within genomic sequence | Genomic accession No. NC_030384.1 Gene Start and end within genomic accession: 27777044 ...... 27782335 |
| CDS Sequence | 108219287 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (ATGAT)2 |
| Repeat start & end within CDS | Repeat start: 1061 Repeat end: 1070 |
| Forward primer | Primer sequence: TGCTGGATACGCTTCCAAGG Tm(°C): 60.108 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: ACCAGCATCCTTCCCCATTG Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 947 End: 1091 Product size (bp): 145 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 108219287 NCBI Gene Symbol: LOC108219287 |
| Gene Aliases | DCAR_013737 |
| Gene description & Other designations | Description: porphobilinogen deaminase; chloroplastic Other designations: porphobilinogen deaminase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 4 Strand: minus Exon count: 6 |
| Gene Location within genomic sequence | Genomic accession No. NC_030384.1 Gene Start and end within genomic accession: 27777044 ...... 27782335 |
| CDS Sequence | 108219287 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (CCG)3 |
| Repeat start & end within CDS | Repeat start: 41 Repeat end: 49 |
| Forward primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Reverse primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Primer start, end within sequence and product size | Start: End: Product size (bp): |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 108219287 NCBI Gene Symbol: LOC108219287 |
| Gene Aliases | DCAR_013737 |
| Gene description & Other designations | Description: porphobilinogen deaminase; chloroplastic Other designations: porphobilinogen deaminase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 4 Strand: minus Exon count: 6 |
| Gene Location within genomic sequence | Genomic accession No. NC_030384.1 Gene Start and end within genomic accession: 27777044 ...... 27782335 |
| CDS Sequence | 108219287 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: AATGACGGTGTTGTGCAAGC Tm(°C): 59.969 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: ACCAGCATCCTTCCCCATTG Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 687 End: 1091 Product size (bp): 405 |
| JBrowse View | JBrowse |
