Statistics
Number of enzymes: 1
Total Number of designed primers: 4
Number of PGTM primers: 1
Number of PMTM primers: 3
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103330036 NCBI Gene Symbol: LOC103330036 |
| Gene Aliases | |
| Gene description & Other designations | Description: cystathionine gamma-synthase 1; chloroplastic-like Other designations: LOW QUALITY PROTEIN: cystathionine gamma-synthase 1; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: plus Exon count: 11 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 22099770 ...... 22106534 |
| CDS Sequence | 103330036 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (CGGGT)2cgacgccacggcgccgtttcacgg(CCTCT)2 |
| Repeat start & end within CDS | Repeat start: 68 Repeat end: 111 |
| Forward primer | Primer sequence: TTTCACCTCTTCCCAACCCG Tm(°C): 59.89 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CGGAATGCCTGAGTTGGAGT Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 29 End: 242 Product size (bp): 214 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103330036 NCBI Gene Symbol: LOC103330036 |
| Gene Aliases | |
| Gene description & Other designations | Description: cystathionine gamma-synthase 1; chloroplastic-like Other designations: LOW QUALITY PROTEIN: cystathionine gamma-synthase 1; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: plus Exon count: 11 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 22099770 ...... 22106534 |
| CDS Sequence | 103330036 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (AAC)3(CAACTC)2* |
| Repeat start & end within CDS | Repeat start: 217 Repeat end: 233 |
| Forward primer | Primer sequence: TTTCCTCCCAACTTCGTCCG Tm(°C): 59.966 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TCAGTAACTATGCCGCGACC Tm(°C): 59.898 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 123 End: 451 Product size (bp): 329 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103330036 NCBI Gene Symbol: LOC103330036 |
| Gene Aliases | |
| Gene description & Other designations | Description: cystathionine gamma-synthase 1; chloroplastic-like Other designations: LOW QUALITY PROTEIN: cystathionine gamma-synthase 1; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: plus Exon count: 11 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 22099770 ...... 22106534 |
| CDS Sequence | 103330036 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (GCCCTT)2 |
| Repeat start & end within CDS | Repeat start: 967 Repeat end: 978 |
| Forward primer | Primer sequence: GAAAGCCCTGGAGTCTGCAT Tm(°C): 60.035 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: ACCGGCAAGGACATCATTGT Tm(°C): 59.962 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 794 End: 1043 Product size (bp): 250 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103330036 NCBI Gene Symbol: LOC103330036 |
| Gene Aliases | |
| Gene description & Other designations | Description: cystathionine gamma-synthase 1; chloroplastic-like Other designations: LOW QUALITY PROTEIN: cystathionine gamma-synthase 1; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: plus Exon count: 11 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 22099770 ...... 22106534 |
| CDS Sequence | 103330036 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GCCTGATTTGAAGGAGGCCT Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: ATGCAGACTCCAGGGCTTTC Tm(°C): 60.035 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 362 End: 813 Product size (bp): 452 |
| JBrowse View | JBrowse |
