Enzyme Id: K01719 |
||||||||||||||||||||||||||||||||||||||||||||||||
| Gene Information | ||||||||||||||||||||||||||||||||||||||||||||||||
| NCBI Gene Accession Number & Symbol | Accession Number: 101262008 NCBI Gene Symbol: LOC101262008 | |||||||||||||||||||||||||||||||||||||||||||||||
| Gene Aliases | ||||||||||||||||||||||||||||||||||||||||||||||||
| Gene description & Other designations | Description: uroporphyrinogen-III synthase; chloroplastic Other designations: uroporphyrinogen-III synthase; chloroplastic | |||||||||||||||||||||||||||||||||||||||||||||||
| Chromosome, Strand & Exon count | Chromosome: 4 Strand: plus Exon count: 10 | |||||||||||||||||||||||||||||||||||||||||||||||
| Gene Location within genomic sequence | Genomic accession No. NC_015441.3 Gene Start and end within genomic accession: 63916409 ...... 63930065 | |||||||||||||||||||||||||||||||||||||||||||||||
| CDS Sequence | 101262008 | |||||||||||||||||||||||||||||||||||||||||||||||
| Marker Information | ||||||||||||||||||||||||||||||||||||||||||||||||
| Marker Type | PMTM | |||||||||||||||||||||||||||||||||||||||||||||||
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (TC)4ctccttct(CTC)3cgttgacga(CGT)3 | |||||||||||||||||||||||||||||||||||||||||||||||
| Repeat start & end within CDS | Repeat start: 7 Repeat end: 49 | |||||||||||||||||||||||||||||||||||||||||||||||
| Forward primer | Primer sequence: None Tm(°C): GC (%): Size: | |||||||||||||||||||||||||||||||||||||||||||||||
| Reverse primer | Primer sequence: None Tm(°C): GC (%): Size: | |||||||||||||||||||||||||||||||||||||||||||||||
| Primer start, end within sequence and product size | Start: End: Product size (bp): | |||||||||||||||||||||||||||||||||||||||||||||||
| JBrowse View | JBrowse | |||||||||||||||||||||||||||||||||||||||||||||||
Enzyme Id: K01719 |
||
| Gene Information | ||
| NCBI Gene Accession Number & Symbol | Accession Number: 101262008 NCBI Gene Symbol: LOC101262008 | |
| Gene Aliases | ||
| Gene description & Other designations | Description: uroporphyrinogen-III synthase; chloroplastic Other designations: uroporphyrinogen-III synthase; chloroplastic | |
| Chromosome, Strand & Exon count | Chromosome: 4 Strand: plus Exon count: 10 | |
| Gene Location within genomic sequence | Genomic accession No. NC_015441.3 Gene Start and end within genomic accession: 63916409 ...... 63930065 | |
| CDS Sequence | 101262008 | |
| Marker Information | ||
| Marker Type | PGTM | |
| Repeat type & sequence | Repeat type: Repeat sequence: | |
| Repeat start & end within CDS | Repeat start: Repeat end: | |
| Forward primer | Primer sequence: CGGCAAGCTCATCAATGCTC Tm(°C): 59.971 GC (%): 55 Size: 20 | |
| Reverse primer | Primer sequence: TCGATGTCAGTGCTGGCTTT Tm(°C): 59.965 GC (%): 50 Size: 20 | |
| Primer start, end within sequence and product size | Start: 185 End: 577 Product size (bp): 393 | |
| JBrowse View | JBrowse | |