image


Statistics

Number of enzymes: 1
Total Number of designed primers: 3
Number of PGTM primers:     1
Number of PMTM primers:     2

Enzyme Id:  K01679
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103333998     NCBI Gene Symbol: LOC103333998
Gene Aliases
Gene description & Other designations Description:   fumarate hydratase 1; mitochondrial      Other designations:   fumarate hydratase 1; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG6     Strand:   minus     Exon count:   14
Gene Location within genomic sequence Genomic accession No. NC_024131.1      Gene Start and end within genomic accession: 961685 ...... 965135
CDS Sequence 103333998
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (CA)4
Repeat start & end within CDS Repeat start: 649     Repeat end: 656
Forward primer Primer sequence:   AGGTCATTGCGAACAGAGCA     Tm(°C): 59.965     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GATACATGCGGGGTAGGGTG     Tm(°C): 59.965     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 412     End: 756     Product size (bp): 345
JBrowse View      JBrowse

Enzyme Id:  K01679
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103333998     NCBI Gene Symbol: LOC103333998
Gene Aliases
Gene description & Other designations Description:   fumarate hydratase 1; mitochondrial      Other designations:   fumarate hydratase 1; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG6     Strand:   minus     Exon count:   14
Gene Location within genomic sequence Genomic accession No. NC_024131.1      Gene Start and end within genomic accession: 961685 ...... 965135
CDS Sequence 103333998
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GCA)3
Repeat start & end within CDS Repeat start: 1037     Repeat end: 1045
Forward primer Primer sequence:   CCGCATGTATCAGCTTGCAC     Tm(°C): 59.971     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGCCTCACACTGAGTAGGGT     Tm(°C): 59.885     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 746     End: 1082     Product size (bp): 337
JBrowse View      JBrowse

Enzyme Id:  K01679
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103333998     NCBI Gene Symbol: LOC103333998
Gene Aliases
Gene description & Other designations Description:   fumarate hydratase 1; mitochondrial      Other designations:   fumarate hydratase 1; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG6     Strand:   minus     Exon count:   14
Gene Location within genomic sequence Genomic accession No. NC_024131.1      Gene Start and end within genomic accession: 961685 ...... 965135
CDS Sequence 103333998
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   AACTGGCAGTGGAACCCAAA     Tm(°C): 60.033     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GTGCAAGCTGATACATGCGG     Tm(°C): 59.971     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 374     End: 765     Product size (bp): 392
JBrowse View      JBrowse