|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103331792 NCBI Gene Symbol: LOC103331792 |
| Gene Aliases | |
| Gene description & Other designations | Description: 2-isopropylmalate synthase 1; chloroplastic-like Other designations: 2-isopropylmalate synthase 1; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: LG1 Strand: plus Exon count: 14 |
| Gene Location within genomic sequence | Genomic accession No. NC_024126.1 Gene Start and end within genomic accession: 14061256 ...... 14070464 |
| CDS Sequence | 103331792 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: CAGCCTCCATGTCCTCGATC Tm(°C): 59.967 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: TCCCAACCTCCTTCGCAATC Tm(°C): 60.035 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 40 End: 453 Product size (bp): 414 |
| JBrowse View | JBrowse |
