image


Statistics

Number of enzymes: 1
Total Number of designed primers: 7
Number of PGTM primers:     1
Number of PMTM primers:     6

Enzyme Id:  K01638
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103338030     NCBI Gene Symbol: LOC103338030
Gene Aliases
Gene description & Other designations Description:   malate synthase; glyoxysomal      Other designations:   malate synthase; glyoxysomal
Chromosome, Strand & Exon count Chromosome:   LG7     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024132.1      Gene Start and end within genomic accession: 12561467 ...... 12564282
CDS Sequence 103338030
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GTG)4
Repeat start & end within CDS Repeat start: 50     Repeat end: 61
Forward primer Primer sequence:   TATACACTGCACCAGCCACC     Tm(°C): 59.748     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCTCTGCAACTCCACCACAA     Tm(°C): 60.179     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 22     End: 170     Product size (bp): 149
JBrowse View      JBrowse

Enzyme Id:  K01638
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103338030     NCBI Gene Symbol: LOC103338030
Gene Aliases
Gene description & Other designations Description:   malate synthase; glyoxysomal      Other designations:   malate synthase; glyoxysomal
Chromosome, Strand & Exon count Chromosome:   LG7     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024132.1      Gene Start and end within genomic accession: 12561467 ...... 12564282
CDS Sequence 103338030
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (AG)4
Repeat start & end within CDS Repeat start: 786     Repeat end: 793
Forward primer Primer sequence:   TGATGGAGAGCCTGCAACTG     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCACAGTTCAGCCCAACAGA     Tm(°C): 60.179     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 599     End: 895     Product size (bp): 297
JBrowse View      JBrowse

Enzyme Id:  K01638
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103338030     NCBI Gene Symbol: LOC103338030
Gene Aliases
Gene description & Other designations Description:   malate synthase; glyoxysomal      Other designations:   malate synthase; glyoxysomal
Chromosome, Strand & Exon count Chromosome:   LG7     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024132.1      Gene Start and end within genomic accession: 12561467 ...... 12564282
CDS Sequence 103338030
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (ACCGG)2
Repeat start & end within CDS Repeat start: 957     Repeat end: 966
Forward primer Primer sequence:   GAGGAAGCATCAGGGCAACT     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TTGCAGCAGGGTCATCTCTG     Tm(°C): 60.036     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 790     End: 1098     Product size (bp): 309
JBrowse View      JBrowse

Enzyme Id:  K01638
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103338030     NCBI Gene Symbol: LOC103338030
Gene Aliases
Gene description & Other designations Description:   malate synthase; glyoxysomal      Other designations:   malate synthase; glyoxysomal
Chromosome, Strand & Exon count Chromosome:   LG7     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024132.1      Gene Start and end within genomic accession: 12561467 ...... 12564282
CDS Sequence 103338030
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AATCC)2
Repeat start & end within CDS Repeat start: 1245     Repeat end: 1254
Forward primer Primer sequence:   ACATGATGGGACTTGGGCAG     Tm(°C): 60.034     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCAGTTCTGCACCCTGCTTA     Tm(°C): 59.963     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1154     End: 1457     Product size (bp): 304
JBrowse View      JBrowse

Enzyme Id:  K01638
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103338030     NCBI Gene Symbol: LOC103338030
Gene Aliases
Gene description & Other designations Description:   malate synthase; glyoxysomal      Other designations:   malate synthase; glyoxysomal
Chromosome, Strand & Exon count Chromosome:   LG7     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024132.1      Gene Start and end within genomic accession: 12561467 ...... 12564282
CDS Sequence 103338030
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TGGAG)2
Repeat start & end within CDS Repeat start: 1473     Repeat end: 1482
Forward primer Primer sequence:   AGGAGTTCGAACGCTGGAAG     Tm(°C): 60.038     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCCTCCACCACTCTCCCAAA     Tm(°C): 60.105     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1310     End: 1543     Product size (bp): 234
JBrowse View      JBrowse

Enzyme Id:  K01638
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103338030     NCBI Gene Symbol: LOC103338030
Gene Aliases
Gene description & Other designations Description:   malate synthase; glyoxysomal      Other designations:   malate synthase; glyoxysomal
Chromosome, Strand & Exon count Chromosome:   LG7     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024132.1      Gene Start and end within genomic accession: 12561467 ...... 12564282
CDS Sequence 103338030
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (GA)4
Repeat start & end within CDS Repeat start: 1561     Repeat end: 1568
Forward primer Primer sequence:   TTGGGAGAGTGGTGGAGGAA     Tm(°C): 60.105     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGAGCCTGGATGATCCCCTT     Tm(°C): 60.029     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1525     End: 1719     Product size (bp): 195
JBrowse View      JBrowse

Enzyme Id:  K01638
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103338030     NCBI Gene Symbol: LOC103338030
Gene Aliases
Gene description & Other designations Description:   malate synthase; glyoxysomal      Other designations:   malate synthase; glyoxysomal
Chromosome, Strand & Exon count Chromosome:   LG7     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024132.1      Gene Start and end within genomic accession: 12561467 ...... 12564282
CDS Sequence 103338030
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   AGGAGTTCGAACGCTGGAAG     Tm(°C): 60.038     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGAGCCTGGATGATCCCCTT     Tm(°C): 60.029     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1310     End: 1719     Product size (bp): 410
JBrowse View      JBrowse