image


Statistics

Number of enzymes: 1
Total Number of designed primers: 26
Number of PGTM primers:     7
Number of PMTM primers:     19
Number of Failed designed PMTM primers: 1

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111436759     NCBI Gene Symbol: LOC111436759
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme 4-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme 4-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111436759
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (ATC)3
Repeat start & end within CDS Repeat start: 217     Repeat end: 225
Forward primer Primer sequence:   CCTCCACGAAGTCCAATGCT     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GTAACGGCAGGAGGAGATCG     Tm(°C): 59.969     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 116     End: 317     Product size (bp): 202
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111436759     NCBI Gene Symbol: LOC111436759
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme 4-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme 4-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111436759
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (CGGCGA)2
Repeat start & end within CDS Repeat start: 828     Repeat end: 839
Forward primer Primer sequence:   CGATGAGGATGACGAGGACG     Tm(°C): 60.041     GC (%): 60     Size: 20
Reverse primer Primer sequence:   GTCACCGAAACCGAGACCTT     Tm(°C): 59.967     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 806     End: 907     Product size (bp): 102
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111436759     NCBI Gene Symbol: LOC111436759
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme 4-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme 4-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111436759
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GCG)3
Repeat start & end within CDS Repeat start: 1067     Repeat end: 1075
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111436759     NCBI Gene Symbol: LOC111436759
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme 4-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme 4-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111436759
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CCTCCACGAAGTCCAATGCT     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GTAACGGCAGGAGGAGATCG     Tm(°C): 59.969     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 116     End: 317     Product size (bp): 202
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111441677     NCBI Gene Symbol: LOC111441677
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111441677
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TCA)3
Repeat start & end within CDS Repeat start: 239     Repeat end: 247
Forward primer Primer sequence:   TTAGCCGAGTGCACCATTGT     Tm(°C): 59.964     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GATGGGGAAAAGACTGGGCA     Tm(°C): 59.96     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 144     End: 384     Product size (bp): 241
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111441677     NCBI Gene Symbol: LOC111441677
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111441677
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GACGTTTCCATCCTCTGCCA     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACAATGGTGCACTCGGCTAA     Tm(°C): 59.964     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 2     End: 163     Product size (bp): 162
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111443864     NCBI Gene Symbol: LOC111443864
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111443864
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (ATCTC)2
Repeat start & end within CDS Repeat start: 204     Repeat end: 213
Forward primer Primer sequence:   GAAGGACTTGGTCTCCGAGC     Tm(°C): 60.109     GC (%): 60     Size: 20
Reverse primer Primer sequence:   CGGTGAGGAGCAGGTTGATT     Tm(°C): 60.036     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 129     End: 424     Product size (bp): 296
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111443864     NCBI Gene Symbol: LOC111443864
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111443864
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TCTCC)2
Repeat start & end within CDS Repeat start: 309     Repeat end: 318
Forward primer Primer sequence:   GAAGGACTTGGTCTCCGAGC     Tm(°C): 60.109     GC (%): 60     Size: 20
Reverse primer Primer sequence:   CGGTGAGGAGCAGGTTGATT     Tm(°C): 60.036     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 129     End: 424     Product size (bp): 296
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111443864     NCBI Gene Symbol: LOC111443864
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111443864
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GCG)3
Repeat start & end within CDS Repeat start: 929     Repeat end: 937
Forward primer Primer sequence:   GCTTTTCTCCGGCGGAATTC     Tm(°C): 59.901     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AAGCACAGCCTCTTCCTCAC     Tm(°C): 59.964     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 886     End: 1157     Product size (bp): 272
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111443864     NCBI Gene Symbol: LOC111443864
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111443864
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (GCT)4gcagtgctggaaggag(GCC)5
Repeat start & end within CDS Repeat start: 1089     Repeat end: 1131
Forward primer Primer sequence:   GCTTTTCTCCGGCGGAATTC     Tm(°C): 59.901     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AAGCACAGCCTCTTCCTCAC     Tm(°C): 59.964     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 886     End: 1157     Product size (bp): 272
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111443864     NCBI Gene Symbol: LOC111443864
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111443864
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GCTTTTCTCCGGCGGAATTC     Tm(°C): 59.901     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AAGCACAGCCTCTTCCTCAC     Tm(°C): 59.964     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 886     End: 1157     Product size (bp): 272
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111450398     NCBI Gene Symbol: LOC111450398
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111450398
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AACTC)2
Repeat start & end within CDS Repeat start: 165     Repeat end: 174
Forward primer Primer sequence:   AAACTGACAGACGCATCGGT     Tm(°C): 59.966     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TCGGAGTTGGAGAGCTGGTA     Tm(°C): 59.961     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 15     End: 229     Product size (bp): 215
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111450398     NCBI Gene Symbol: LOC111450398
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111450398
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (TCTCC)2attccgatgattctccaactcgctgattcgctctcactcgc(CGCCG
T)2
Repeat start & end within CDS Repeat start: 315     Repeat end: 377
Forward primer Primer sequence:   TACCAGCTCTCCAACTCCGA     Tm(°C): 59.961     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CGATTTCACGGCCGAGTAGA     Tm(°C): 59.9     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 210     End: 554     Product size (bp): 345
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111450398     NCBI Gene Symbol: LOC111450398
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111450398
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CTTTGACACAACGGAGCTGC     Tm(°C): 60.041     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GCTTCACCACGTTGTCACAC     Tm(°C): 59.972     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 845     End: 1008     Product size (bp): 164
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111452448     NCBI Gene Symbol: LOC111452448
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111452448
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (ATGGGC)2
Repeat start & end within CDS Repeat start: 91     Repeat end: 102
Forward primer Primer sequence:   CCTGGCATTTTTGCTGACCC     Tm(°C): 60.037     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AAGCTGCGATGGGGAAAAGA     Tm(°C): 59.962     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 69     End: 391     Product size (bp): 323
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111452448     NCBI Gene Symbol: LOC111452448
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111452448
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TCA)3
Repeat start & end within CDS Repeat start: 239     Repeat end: 247
Forward primer Primer sequence:   CCTGGCATTTTTGCTGACCC     Tm(°C): 60.037     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AAGCTGCGATGGGGAAAAGA     Tm(°C): 59.962     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 69     End: 391     Product size (bp): 323
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111452448     NCBI Gene Symbol: LOC111452448
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111452448
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TTTTCCCCATCGCAGCTTCT     Tm(°C): 59.962     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CAGCTTACACAGGTCCACGT     Tm(°C): 59.966     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 374     End: 824     Product size (bp): 451
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111457438     NCBI Gene Symbol: LOC111457438
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme 4-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme 4-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111457438
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (ATC)3
Repeat start & end within CDS Repeat start: 217     Repeat end: 225
Forward primer Primer sequence:   CTTGATCGTCTCCTCCGTCG     Tm(°C): 59.972     GC (%): 60     Size: 20
Reverse primer Primer sequence:   AAGCTCGAATGGGGAAAGGG     Tm(°C): 60.034     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 134     End: 370     Product size (bp): 237
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111457438     NCBI Gene Symbol: LOC111457438
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme 4-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme 4-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111457438
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CCG)3
Repeat start & end within CDS Repeat start: 479     Repeat end: 487
Forward primer Primer sequence:   CCCTTTCCCCATTCGAGCTT     Tm(°C): 60.034     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCTCCTTTCCGGCCGAATTC     Tm(°C): 60.108     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 351     End: 627     Product size (bp): 277
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111457438     NCBI Gene Symbol: LOC111457438
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme 4-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme 4-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111457438
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CCGGC)2
Repeat start & end within CDS Repeat start: 585     Repeat end: 594
Forward primer Primer sequence:   CCCTTTCCCCATTCGAGCTT     Tm(°C): 60.034     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCTCCTTTCCGGCCGAATTC     Tm(°C): 60.108     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 351     End: 627     Product size (bp): 277
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111457438     NCBI Gene Symbol: LOC111457438
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme 4-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme 4-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111457438
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GTCGG)2
Repeat start & end within CDS Repeat start: 790     Repeat end: 799
Forward primer Primer sequence:   GAATTCGGCCGGAAAGGAGA     Tm(°C): 60.108     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CGGCACTTAAATCCAAGCGG     Tm(°C): 59.901     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 608     End: 949     Product size (bp): 342
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111457438     NCBI Gene Symbol: LOC111457438
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme 4-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme 4-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111457438
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CGC)3
Repeat start & end within CDS Repeat start: 915     Repeat end: 923
Forward primer Primer sequence:   AGTGTGTCGGGTCGGTTTAC     Tm(°C): 59.967     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CGGCACTTAAATCCAAGCGG     Tm(°C): 59.901     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 784     End: 949     Product size (bp): 166
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111457438     NCBI Gene Symbol: LOC111457438
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme 4-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme 4-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111457438
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AGTGT)2
Repeat start & end within CDS Repeat start: 985     Repeat end: 994
Forward primer Primer sequence:   AGTGTGTCGGGTCGGTTTAC     Tm(°C): 59.967     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CTATTTCCTGCGAGCCGTGA     Tm(°C): 60.179     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 784     End: 1022     Product size (bp): 239
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111457438     NCBI Gene Symbol: LOC111457438
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme 4-like      Other designations:   S-adenosylmethionine decarboxylase proenzyme 4-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111457438
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CTTGATCGTCTCCTCCGTCG     Tm(°C): 59.972     GC (%): 60     Size: 20
Reverse primer Primer sequence:   AAGCTCGAATGGGGAAAGGG     Tm(°C): 60.034     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 134     End: 370     Product size (bp): 237
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111460332     NCBI Gene Symbol: LOC111460332
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme 4      Other designations:   S-adenosylmethionine decarboxylase proenzyme 4
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111460332
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (ATC)3
Repeat start & end within CDS Repeat start: 220     Repeat end: 228
Forward primer Primer sequence:   CCTTCGCCAAATCAGCTTCG     Tm(°C): 59.902     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GTGAGGGAAAGGCTGTGACA     Tm(°C): 59.891     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 83     End: 365     Product size (bp): 283
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111460332     NCBI Gene Symbol: LOC111460332
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme 4      Other designations:   S-adenosylmethionine decarboxylase proenzyme 4
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111460332
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (ACG)4
Repeat start & end within CDS Repeat start: 794     Repeat end: 805
Forward primer Primer sequence:   ACTCCACCATCCATGTCACG     Tm(°C): 59.75     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CGCGCTGTGAAGGTTTGAAA     Tm(°C): 59.971     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 724     End: 1012     Product size (bp): 289
JBrowse View      JBrowse

Enzyme Id:  K01611
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111460332     NCBI Gene Symbol: LOC111460332
Gene Aliases
Gene description & Other designations Description:   S-adenosylmethionine decarboxylase proenzyme 4      Other designations:   S-adenosylmethionine decarboxylase proenzyme 4
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111460332
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CCTTCGCCAAATCAGCTTCG     Tm(°C): 59.902     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AAGCATGTGAGGGGAGGTTG     Tm(°C): 59.961     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 83     End: 468     Product size (bp): 386
JBrowse View      JBrowse