image


Statistics

Number of enzymes: 1
Total Number of designed primers: 12
Number of PGTM primers:     3
Number of PMTM primers:     9
Number of Failed designed PMTM primers: 2

Enzyme Id:  K01610
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335532     NCBI Gene Symbol: LOC103335532
Gene Aliases
Gene description & Other designations Description:   phosphoenolpyruvate carboxykinase [ATP]-like      Other designations:   phosphoenolpyruvate carboxykinase [ATP]-like
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   13
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 18453503 ...... 18458960
CDS Sequence 103335532
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (AGA)3
Repeat start & end within CDS Repeat start: 191     Repeat end: 199
Forward primer Primer sequence:   ATGGGATGTGTCACGACGAC     Tm(°C): 60.109     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GAAACCTTGGGCGTCTCAGA     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 121     End: 385     Product size (bp): 265
JBrowse View      JBrowse

Enzyme Id:  K01610
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335532     NCBI Gene Symbol: LOC103335532
Gene Aliases
Gene description & Other designations Description:   phosphoenolpyruvate carboxykinase [ATP]-like      Other designations:   phosphoenolpyruvate carboxykinase [ATP]-like
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   13
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 18453503 ...... 18458960
CDS Sequence 103335532
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (AGC)3tccagtccatcagtgcatctttggcttcgctgac(GA)4
Repeat start & end within CDS Repeat start: 278     Repeat end: 328
Forward primer Primer sequence:   CGATCAAGGGCACTCAAGGT     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GAAACCTTGGGCGTCTCAGA     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 217     End: 385     Product size (bp): 169
JBrowse View      JBrowse

Enzyme Id:  K01610
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335532     NCBI Gene Symbol: LOC103335532
Gene Aliases
Gene description & Other designations Description:   phosphoenolpyruvate carboxykinase [ATP]-like      Other designations:   phosphoenolpyruvate carboxykinase [ATP]-like
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   13
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 18453503 ...... 18458960
CDS Sequence 103335532
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (CACCAT)2
Repeat start & end within CDS Repeat start: 400     Repeat end: 411
Forward primer Primer sequence:   TCTGAGACGCCCAAGGTTTC     Tm(°C): 59.965     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGAGTTGCTAATGCGCCTGT     Tm(°C): 60.036     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 366     End: 553     Product size (bp): 188
JBrowse View      JBrowse

Enzyme Id:  K01610
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335532     NCBI Gene Symbol: LOC103335532
Gene Aliases
Gene description & Other designations Description:   phosphoenolpyruvate carboxykinase [ATP]-like      Other designations:   phosphoenolpyruvate carboxykinase [ATP]-like
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   13
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 18453503 ...... 18458960
CDS Sequence 103335532
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (AC)4
Repeat start & end within CDS Repeat start: 914     Repeat end: 921
Forward primer Primer sequence:   CTGGCCAGTTCCCGTGTAAT     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGCCGAGGATGACCATTTCC     Tm(°C): 60.107     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 889     End: 984     Product size (bp): 96
JBrowse View      JBrowse

Enzyme Id:  K01610
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335532     NCBI Gene Symbol: LOC103335532
Gene Aliases
Gene description & Other designations Description:   phosphoenolpyruvate carboxykinase [ATP]-like      Other designations:   phosphoenolpyruvate carboxykinase [ATP]-like
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   13
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 18453503 ...... 18458960
CDS Sequence 103335532
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (GAACGG)2
Repeat start & end within CDS Repeat start: 9     Repeat end: 20
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K01610
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335532     NCBI Gene Symbol: LOC103335532
Gene Aliases
Gene description & Other designations Description:   phosphoenolpyruvate carboxykinase [ATP]-like      Other designations:   phosphoenolpyruvate carboxykinase [ATP]-like
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   13
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 18453503 ...... 18458960
CDS Sequence 103335532
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TCTGAGACGCCCAAGGTTTC     Tm(°C): 59.965     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGAGTTGCTAATGCGCCTGT     Tm(°C): 60.036     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 366     End: 553     Product size (bp): 188
JBrowse View      JBrowse

Enzyme Id:  K01610
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335542     NCBI Gene Symbol: LOC103335542
Gene Aliases
Gene description & Other designations Description:   phosphoenolpyruvate carboxykinase [ATP]-like      Other designations:   phosphoenolpyruvate carboxykinase [ATP]-like
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   12
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 18462519 ...... 18465910
CDS Sequence 103335542
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (AC)4
Repeat start & end within CDS Repeat start: 602     Repeat end: 609
Forward primer Primer sequence:   CACAACATGTGCATCCGACC     Tm(°C): 59.831     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GTGGAGGGAGAGGATTTGGC     Tm(°C): 60.107     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 504     End: 755     Product size (bp): 252
JBrowse View      JBrowse

Enzyme Id:  K01610
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335542     NCBI Gene Symbol: LOC103335542
Gene Aliases
Gene description & Other designations Description:   phosphoenolpyruvate carboxykinase [ATP]-like      Other designations:   phosphoenolpyruvate carboxykinase [ATP]-like
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   12
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 18462519 ...... 18465910
CDS Sequence 103335542
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CTGGT)2
Repeat start & end within CDS Repeat start: 1386     Repeat end: 1395
Forward primer Primer sequence:   TGGCACAGACCATGTACCAC     Tm(°C): 59.964     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCGGAGTGGATGGCATCAAT     Tm(°C): 60.179     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1186     End: 1465     Product size (bp): 280
JBrowse View      JBrowse

Enzyme Id:  K01610
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335542     NCBI Gene Symbol: LOC103335542
Gene Aliases
Gene description & Other designations Description:   phosphoenolpyruvate carboxykinase [ATP]-like      Other designations:   phosphoenolpyruvate carboxykinase [ATP]-like
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   12
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 18462519 ...... 18465910
CDS Sequence 103335542
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (TGAGAC)2
Repeat start & end within CDS Repeat start: 12     Repeat end: 23
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K01610
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335542     NCBI Gene Symbol: LOC103335542
Gene Aliases
Gene description & Other designations Description:   phosphoenolpyruvate carboxykinase [ATP]-like      Other designations:   phosphoenolpyruvate carboxykinase [ATP]-like
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   12
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 18462519 ...... 18465910
CDS Sequence 103335542
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TCGAATTCATCCCCAACGCA     Tm(°C): 60.036     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CCGGATCCATAGCTTCCACC     Tm(°C): 59.965     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 1075     End: 1411     Product size (bp): 337
JBrowse View      JBrowse

Enzyme Id:  K01610
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103319416     NCBI Gene Symbol: LOC103319416
Gene Aliases
Gene description & Other designations Description:   phosphoenolpyruvate carboxykinase [ATP]-like      Other designations:   phosphoenolpyruvate carboxykinase [ATP]-like
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   14
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 4043178 ...... 4048626
CDS Sequence 103319416
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (AGA)3
Repeat start & end within CDS Repeat start: 176     Repeat end: 184
Forward primer Primer sequence:   CCTGTGAAGGCGAAGACCAT     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACTGACGCCAAAGAGGGAAG     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 135     End: 413     Product size (bp): 279
JBrowse View      JBrowse

Enzyme Id:  K01610
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103319416     NCBI Gene Symbol: LOC103319416
Gene Aliases
Gene description & Other designations Description:   phosphoenolpyruvate carboxykinase [ATP]-like      Other designations:   phosphoenolpyruvate carboxykinase [ATP]-like
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   14
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 4043178 ...... 4048626
CDS Sequence 103319416
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (AGC)3
Repeat start & end within CDS Repeat start: 260     Repeat end: 268
Forward primer Primer sequence:   CCTGTGAAGGCGAAGACCAT     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACTGACGCCAAAGAGGGAAG     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 135     End: 413     Product size (bp): 279
JBrowse View      JBrowse

Enzyme Id:  K01610
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103319416     NCBI Gene Symbol: LOC103319416
Gene Aliases
Gene description & Other designations Description:   phosphoenolpyruvate carboxykinase [ATP]-like      Other designations:   phosphoenolpyruvate carboxykinase [ATP]-like
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   14
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 4043178 ...... 4048626
CDS Sequence 103319416
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (TC)4
Repeat start & end within CDS Repeat start: 450     Repeat end: 457
Forward primer Primer sequence:   CTTCCCTCTTTGGCGTCAGT     Tm(°C): 59.965     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACGACCAGTCTTTGCTCCAG     Tm(°C): 59.966     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 394     End: 554     Product size (bp): 161
JBrowse View      JBrowse

Enzyme Id:  K01610
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103319416     NCBI Gene Symbol: LOC103319416
Gene Aliases
Gene description & Other designations Description:   phosphoenolpyruvate carboxykinase [ATP]-like      Other designations:   phosphoenolpyruvate carboxykinase [ATP]-like
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   14
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 4043178 ...... 4048626
CDS Sequence 103319416
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   ACAATCTACAATGCCGGGCA     Tm(°C): 60.035     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CCCAGTGCCTGATAAGCCAA     Tm(°C): 60.034     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 855     End: 1109     Product size (bp): 255
JBrowse View      JBrowse