image


Statistics

Number of enzymes: 1
Total Number of designed primers: 7
Number of PGTM primers:     2
Number of PMTM primers:     5

Enzyme Id:  K01599
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108196658     NCBI Gene Symbol: LOC108196658
Gene Aliases DCAR_024057
Gene description & Other designations Description:   uroporphyrinogen decarboxylase      Other designations:   uroporphyrinogen decarboxylase
Chromosome, Strand & Exon count Chromosome:   7     Strand:   plus     Exon count:   6
Gene Location within genomic sequence Genomic accession No. NC_030387.1      Gene Start and end within genomic accession: 8445348 ...... 8453671
CDS Sequence 108196658
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TTGGA)2
Repeat start & end within CDS Repeat start: 940     Repeat end: 949
Forward primer Primer sequence:   AACCAAAGGTCCTTCACGCA     Tm(°C): 60.107     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TTTCCCTGGACTGCCACATC     Tm(°C): 59.962     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 661     End: 1006     Product size (bp): 346
JBrowse View      JBrowse

Enzyme Id:  K01599
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108196658     NCBI Gene Symbol: LOC108196658
Gene Aliases DCAR_024057
Gene description & Other designations Description:   uroporphyrinogen decarboxylase      Other designations:   uroporphyrinogen decarboxylase
Chromosome, Strand & Exon count Chromosome:   7     Strand:   plus     Exon count:   6
Gene Location within genomic sequence Genomic accession No. NC_030387.1      Gene Start and end within genomic accession: 8445348 ...... 8453671
CDS Sequence 108196658
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   AACCAAAGGTCCTTCACGCA     Tm(°C): 60.107     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TTTCCCTGGACTGCCACATC     Tm(°C): 59.962     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 661     End: 1006     Product size (bp): 346
JBrowse View      JBrowse

Enzyme Id:  K01599
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108226397     NCBI Gene Symbol: LOC108226397
Gene Aliases DCAR_021024
Gene description & Other designations Description:   uroporphyrinogen decarboxylase 1; chloroplastic      Other designations:   uroporphyrinogen decarboxylase 1; chloroplastic
Chromosome, Strand & Exon count Chromosome:   6     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_030386.1      Gene Start and end within genomic accession: 26508384 ...... 26512850
CDS Sequence 108226397
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (ATC)3
Repeat start & end within CDS Repeat start: 51     Repeat end: 59
Forward primer Primer sequence:   AGCTTCTTCACTTGTGTTCCA     Tm(°C): 57.718     GC (%): 42.857     Size: 21
Reverse primer Primer sequence:   TCCTTTTGCAGCCTTGACCA     Tm(°C): 60.106     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 6     End: 188     Product size (bp): 183
JBrowse View      JBrowse

Enzyme Id:  K01599
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108226397     NCBI Gene Symbol: LOC108226397
Gene Aliases DCAR_021024
Gene description & Other designations Description:   uroporphyrinogen decarboxylase 1; chloroplastic      Other designations:   uroporphyrinogen decarboxylase 1; chloroplastic
Chromosome, Strand & Exon count Chromosome:   6     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_030386.1      Gene Start and end within genomic accession: 26508384 ...... 26512850
CDS Sequence 108226397
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (AG)4
Repeat start & end within CDS Repeat start: 283     Repeat end: 290
Forward primer Primer sequence:   TGGTCAAGGCTGCAAAAGGA     Tm(°C): 60.106     GC (%): 50     Size: 20
Reverse primer Primer sequence:   AGGTCCTCCTCCAAACGGAT     Tm(°C): 60.253     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 169     End: 469     Product size (bp): 301
JBrowse View      JBrowse

Enzyme Id:  K01599
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108226397     NCBI Gene Symbol: LOC108226397
Gene Aliases DCAR_021024
Gene description & Other designations Description:   uroporphyrinogen decarboxylase 1; chloroplastic      Other designations:   uroporphyrinogen decarboxylase 1; chloroplastic
Chromosome, Strand & Exon count Chromosome:   6     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_030386.1      Gene Start and end within genomic accession: 26508384 ...... 26512850
CDS Sequence 108226397
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GGA)3
Repeat start & end within CDS Repeat start: 459     Repeat end: 467
Forward primer Primer sequence:   ACCTGCATTTGGTGTCCCAT     Tm(°C): 59.885     GC (%): 50     Size: 20
Reverse primer Primer sequence:   AAGCCCAAAACTGCAGCTTG     Tm(°C): 59.895     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 389     End: 571     Product size (bp): 183
JBrowse View      JBrowse

Enzyme Id:  K01599
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108226397     NCBI Gene Symbol: LOC108226397
Gene Aliases DCAR_021024
Gene description & Other designations Description:   uroporphyrinogen decarboxylase 1; chloroplastic      Other designations:   uroporphyrinogen decarboxylase 1; chloroplastic
Chromosome, Strand & Exon count Chromosome:   6     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_030386.1      Gene Start and end within genomic accession: 26508384 ...... 26512850
CDS Sequence 108226397
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (TGGAC)3agtggatatggcagatg(GAA)3
Repeat start & end within CDS Repeat start: 936     Repeat end: 976
Forward primer Primer sequence:   AAAAGTGCCCAGATACGCCA     Tm(°C): 59.962     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CCTCTGGTGTCCCGACTAGA     Tm(°C): 60.034     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 847     End: 1137     Product size (bp): 291
JBrowse View      JBrowse

Enzyme Id:  K01599
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108226397     NCBI Gene Symbol: LOC108226397
Gene Aliases DCAR_021024
Gene description & Other designations Description:   uroporphyrinogen decarboxylase 1; chloroplastic      Other designations:   uroporphyrinogen decarboxylase 1; chloroplastic
Chromosome, Strand & Exon count Chromosome:   6     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_030386.1      Gene Start and end within genomic accession: 26508384 ...... 26512850
CDS Sequence 108226397
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TGGAATCTGGCGCTCATTGT     Tm(°C): 60.035     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CCTCTGGTGTCCCGACTAGA     Tm(°C): 60.034     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 730     End: 1137     Product size (bp): 408
JBrowse View      JBrowse