image


Statistics

Number of enzymes: 1
Total Number of designed primers: 11
Number of PGTM primers:     2
Number of PMTM primers:     9

Enzyme Id:  K01597
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111467606     NCBI Gene Symbol: LOC111467606
Gene Aliases
Gene description & Other designations Description:   diphosphomevalonate decarboxylase MVD2; peroxisomal-like      Other designations:   diphosphomevalonate decarboxylase MVD2; peroxisomal-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111467606
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AAGAA)2
Repeat start & end within CDS Repeat start: 305     Repeat end: 314
Forward primer Primer sequence:   CCCGACTTCGAGAAGGATCG     Tm(°C): 59.97     GC (%): 60     Size: 20
Reverse primer Primer sequence:   CAAGACAAGCAAAACCGGCA     Tm(°C): 59.898     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 189     End: 426     Product size (bp): 238
JBrowse View      JBrowse

Enzyme Id:  K01597
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111467606     NCBI Gene Symbol: LOC111467606
Gene Aliases
Gene description & Other designations Description:   diphosphomevalonate decarboxylase MVD2; peroxisomal-like      Other designations:   diphosphomevalonate decarboxylase MVD2; peroxisomal-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111467606
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (CTG)3(TGGCT)2*tcctctgctgccggttttg(CTTGT)2
Repeat start & end within CDS Repeat start: 383     Repeat end: 428
Forward primer Primer sequence:   CCCGACTTCGAGAAGGATCG     Tm(°C): 59.97     GC (%): 60     Size: 20
Reverse primer Primer sequence:   AGCTACGACATGCACTTCCC     Tm(°C): 60.108     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 189     End: 519     Product size (bp): 331
JBrowse View      JBrowse

Enzyme Id:  K01597
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111467606     NCBI Gene Symbol: LOC111467606
Gene Aliases
Gene description & Other designations Description:   diphosphomevalonate decarboxylase MVD2; peroxisomal-like      Other designations:   diphosphomevalonate decarboxylase MVD2; peroxisomal-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111467606
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GCAAG)2
Repeat start & end within CDS Repeat start: 487     Repeat end: 496
Forward primer Primer sequence:   CCCGACTTCGAGAAGGATCG     Tm(°C): 59.97     GC (%): 60     Size: 20
Reverse primer Primer sequence:   AGCTACGACATGCACTTCCC     Tm(°C): 60.108     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 189     End: 519     Product size (bp): 331
JBrowse View      JBrowse

Enzyme Id:  K01597
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111467606     NCBI Gene Symbol: LOC111467606
Gene Aliases
Gene description & Other designations Description:   diphosphomevalonate decarboxylase MVD2; peroxisomal-like      Other designations:   diphosphomevalonate decarboxylase MVD2; peroxisomal-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111467606
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GAAAA)2
Repeat start & end within CDS Repeat start: 551     Repeat end: 560
Forward primer Primer sequence:   GGGAAGTGCATGTCGTAGCT     Tm(°C): 60.108     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TTGGTTGCTGTCGTTGCATG     Tm(°C): 59.969     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 500     End: 818     Product size (bp): 319
JBrowse View      JBrowse

Enzyme Id:  K01597
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111467606     NCBI Gene Symbol: LOC111467606
Gene Aliases
Gene description & Other designations Description:   diphosphomevalonate decarboxylase MVD2; peroxisomal-like      Other designations:   diphosphomevalonate decarboxylase MVD2; peroxisomal-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111467606
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CATGCAACGACAGCAACCAA     Tm(°C): 59.969     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GGCCCGGCATCGAAAGTATA     Tm(°C): 59.966     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 799     End: 955     Product size (bp): 157
JBrowse View      JBrowse

Enzyme Id:  K01597
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111479145     NCBI Gene Symbol: LOC111479145
Gene Aliases
Gene description & Other designations Description:   diphosphomevalonate decarboxylase MVD2; peroxisomal-like      Other designations:   diphosphomevalonate decarboxylase MVD2; peroxisomal-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111479145
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (CTG)3(TGGCT)2*tcctctgctgccggttttg(CTTGT)2
Repeat start & end within CDS Repeat start: 383     Repeat end: 428
Forward primer Primer sequence:   ATGTGGCTCAATCGCAAGGA     Tm(°C): 60.035     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CCATATAAGCTGCGGCATGC     Tm(°C): 59.83     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 210     End: 526     Product size (bp): 317
JBrowse View      JBrowse

Enzyme Id:  K01597
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111479145     NCBI Gene Symbol: LOC111479145
Gene Aliases
Gene description & Other designations Description:   diphosphomevalonate decarboxylase MVD2; peroxisomal-like      Other designations:   diphosphomevalonate decarboxylase MVD2; peroxisomal-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111479145
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GCAAG)2
Repeat start & end within CDS Repeat start: 487     Repeat end: 496
Forward primer Primer sequence:   ATGTGGCTCAATCGCAAGGA     Tm(°C): 60.035     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CCATATAAGCTGCGGCATGC     Tm(°C): 59.83     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 210     End: 526     Product size (bp): 317
JBrowse View      JBrowse

Enzyme Id:  K01597
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111479145     NCBI Gene Symbol: LOC111479145
Gene Aliases
Gene description & Other designations Description:   diphosphomevalonate decarboxylase MVD2; peroxisomal-like      Other designations:   diphosphomevalonate decarboxylase MVD2; peroxisomal-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111479145
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GAAAA)2
Repeat start & end within CDS Repeat start: 551     Repeat end: 560
Forward primer Primer sequence:   TGCCGGTTTTGCTTGTCTTG     Tm(°C): 59.898     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CATCCCAGTGCTTCTCGTCA     Tm(°C): 59.753     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 407     End: 612     Product size (bp): 206
JBrowse View      JBrowse

Enzyme Id:  K01597
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111479145     NCBI Gene Symbol: LOC111479145
Gene Aliases
Gene description & Other designations Description:   diphosphomevalonate decarboxylase MVD2; peroxisomal-like      Other designations:   diphosphomevalonate decarboxylase MVD2; peroxisomal-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111479145
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GACAA)2
Repeat start & end within CDS Repeat start: 1069     Repeat end: 1078
Forward primer Primer sequence:   TATACTTTCGACGCAGGCCC     Tm(°C): 59.896     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGGGGTCGAGTAGAGCTTCA     Tm(°C): 59.961     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 936     End: 1248     Product size (bp): 313
JBrowse View      JBrowse

Enzyme Id:  K01597
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111479145     NCBI Gene Symbol: LOC111479145
Gene Aliases
Gene description & Other designations Description:   diphosphomevalonate decarboxylase MVD2; peroxisomal-like      Other designations:   diphosphomevalonate decarboxylase MVD2; peroxisomal-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111479145
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CCAGG)2
Repeat start & end within CDS Repeat start: 1193     Repeat end: 1202
Forward primer Primer sequence:   TATACTTTCGACGCAGGCCC     Tm(°C): 59.896     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGGGGTCGAGTAGAGCTTCA     Tm(°C): 59.961     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 936     End: 1248     Product size (bp): 313
JBrowse View      JBrowse

Enzyme Id:  K01597
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111479145     NCBI Gene Symbol: LOC111479145
Gene Aliases
Gene description & Other designations Description:   diphosphomevalonate decarboxylase MVD2; peroxisomal-like      Other designations:   diphosphomevalonate decarboxylase MVD2; peroxisomal-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111479145
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   ATGGGTGCTGATGACCACTG     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCCTTGCGATTGAGCCACAT     Tm(°C): 60.035     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 32     End: 229     Product size (bp): 198
JBrowse View      JBrowse