|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103341411 NCBI Gene Symbol: LOC103341411 |
| Gene Aliases | |
| Gene description & Other designations | Description: phosphoenolpyruvate carboxylase 4 Other designations: phosphoenolpyruvate carboxylase 4 |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 103341411 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (CTATG)2aatctttgcaatcatgtggatctggagtgctagctgacggtcgactt
g(CTGAT)2 |
| Repeat start & end within CDS | Repeat start: 1522 Repeat end: 1589 |
| Forward primer | Primer sequence: CCCCTCAGAGACCTGGAGTT Tm(°C): 60.252 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: GTCTACCAGATTCCTGACGCA Tm(°C): 59.523 GC (%): 52.381 Size: 21 |
| Primer start, end within sequence and product size | Start: 1354 End: 1653 Product size (bp): 300 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103341411 NCBI Gene Symbol: LOC103341411 |
| Gene Aliases | |
| Gene description & Other designations | Description: phosphoenolpyruvate carboxylase 4 Other designations: phosphoenolpyruvate carboxylase 4 |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 103341411 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (GAA)3(AAGAA)2* |
| Repeat start & end within CDS | Repeat start: 1714 Repeat end: 1727 |
| Forward primer | Primer sequence: ACGGTCGACTTGCTGATCTG Tm(°C): 60.109 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GACATCACTTGCACGTGACG Tm(°C): 59.838 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 1567 End: 1898 Product size (bp): 332 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103341411 NCBI Gene Symbol: LOC103341411 |
| Gene Aliases | |
| Gene description & Other designations | Description: phosphoenolpyruvate carboxylase 4 Other designations: phosphoenolpyruvate carboxylase 4 |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 103341411 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (ATTCTG)2 |
| Repeat start & end within CDS | Repeat start: 2117 Repeat end: 2128 |
| Forward primer | Primer sequence: ATTGGAAGGCCATGTCCAGG Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TTGCATGCAGCCACAACATC Tm(°C): 60.038 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 1950 End: 2200 Product size (bp): 251 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103341411 NCBI Gene Symbol: LOC103341411 |
| Gene Aliases | |
| Gene description & Other designations | Description: phosphoenolpyruvate carboxylase 4 Other designations: phosphoenolpyruvate carboxylase 4 |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 103341411 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (CTTGG)2(TTGGAG)2* |
| Repeat start & end within CDS | Repeat start: 2687 Repeat end: 2704 |
| Forward primer | Primer sequence: TTGCATGGACCCAAACCAGA Tm(°C): 59.813 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: GATAGCTTCTCATGCCCGCT Tm(°C): 59.965 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 2653 End: 2953 Product size (bp): 301 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103341411 NCBI Gene Symbol: LOC103341411 |
| Gene Aliases | |
| Gene description & Other designations | Description: phosphoenolpyruvate carboxylase 4 Other designations: phosphoenolpyruvate carboxylase 4 |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 103341411 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: ATTGGAAGGCCATGTCCAGG Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CTCCTTGCTCAGTTGACCGT Tm(°C): 59.966 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 1950 End: 2337 Product size (bp): 388 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103328478 NCBI Gene Symbol: LOC103328478 |
| Gene Aliases | |
| Gene description & Other designations | Description: phosphoenolpyruvate carboxylase 2 Other designations: phosphoenolpyruvate carboxylase 2 |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: minus Exon count: 10 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 10352526 ...... 10358701 |
| CDS Sequence | 103328478 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (AGATG)2 |
| Repeat start & end within CDS | Repeat start: 699 Repeat end: 708 |
| Forward primer | Primer sequence: AAGGACTCCTCCAACCCCTC Tm(°C): 60.548 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: GTCCCCACCCATCCAAGAAG Tm(°C): 60.034 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 677 End: 860 Product size (bp): 184 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103328478 NCBI Gene Symbol: LOC103328478 |
| Gene Aliases | |
| Gene description & Other designations | Description: phosphoenolpyruvate carboxylase 2 Other designations: phosphoenolpyruvate carboxylase 2 |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: minus Exon count: 10 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 10352526 ...... 10358701 |
| CDS Sequence | 103328478 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Di Repeat sequence: (CT)4 |
| Repeat start & end within CDS | Repeat start: 1324 Repeat end: 1331 |
| Forward primer | Primer sequence: TGTGTTACCGGTCACTCTGC Tm(°C): 59.967 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CCAATCTCCAGGTGCCTTGT Tm(°C): 59.961 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 1234 End: 1408 Product size (bp): 175 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103328478 NCBI Gene Symbol: LOC103328478 |
| Gene Aliases | |
| Gene description & Other designations | Description: phosphoenolpyruvate carboxylase 2 Other designations: phosphoenolpyruvate carboxylase 2 |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: minus Exon count: 10 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 10352526 ...... 10358701 |
| CDS Sequence | 103328478 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (CTG)3 |
| Repeat start & end within CDS | Repeat start: 1706 Repeat end: 1714 |
| Forward primer | Primer sequence: TGCTGATCTTGAGGCTGCTC Tm(°C): 60.108 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: ATGAATTGTGTCGGGTGGCT Tm(°C): 59.962 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 1685 End: 1976 Product size (bp): 292 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103328478 NCBI Gene Symbol: LOC103328478 |
| Gene Aliases | |
| Gene description & Other designations | Description: phosphoenolpyruvate carboxylase 2 Other designations: phosphoenolpyruvate carboxylase 2 |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: minus Exon count: 10 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 10352526 ...... 10358701 |
| CDS Sequence | 103328478 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (GAG)3 |
| Repeat start & end within CDS | Repeat start: 1922 Repeat end: 1930 |
| Forward primer | Primer sequence: TGGTCGAGGTGGAACAGTTG Tm(°C): 59.894 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TCCGTGCTCAAGTGTAGCTG Tm(°C): 60.038 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 1898 End: 2087 Product size (bp): 190 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103328478 NCBI Gene Symbol: LOC103328478 |
| Gene Aliases | |
| Gene description & Other designations | Description: phosphoenolpyruvate carboxylase 2 Other designations: phosphoenolpyruvate carboxylase 2 |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: minus Exon count: 10 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 10352526 ...... 10358701 |
| CDS Sequence | 103328478 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Di Repeat sequence: (GA)4 |
| Repeat start & end within CDS | Repeat start: 2552 Repeat end: 2559 |
| Forward primer | Primer sequence: TGGGTTTGGGGCAGCATTTA Tm(°C): 60.179 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: CAACCTGGAGGACAAGGCTC Tm(°C): 60.322 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 2357 End: 2604 Product size (bp): 248 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103328478 NCBI Gene Symbol: LOC103328478 |
| Gene Aliases | |
| Gene description & Other designations | Description: phosphoenolpyruvate carboxylase 2 Other designations: phosphoenolpyruvate carboxylase 2 |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: minus Exon count: 10 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 10352526 ...... 10358701 |
| CDS Sequence | 103328478 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: CTTCTTGGATGGGTGGGGAC Tm(°C): 60.034 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: GCAGAGTGACCGGTAACACA Tm(°C): 59.967 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 841 End: 1253 Product size (bp): 413 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103326102 NCBI Gene Symbol: LOC103326102 |
| Gene Aliases | |
| Gene description & Other designations | Description: phosphoenolpyruvate carboxylase; housekeeping isozyme Other designations: phosphoenolpyruvate carboxylase; housekeeping isozyme |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: minus Exon count: 11 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 11407433 ...... 11414160 |
| CDS Sequence | 103326102 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (TTG)3 |
| Repeat start & end within CDS | Repeat start: 275 Repeat end: 283 |
| Forward primer | Primer sequence: CTGGAGAAGTTGGCGTCCAT Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: AGCTTGTTTCGTCTGCGGTA Tm(°C): 59.967 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 15 End: 361 Product size (bp): 347 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103326102 NCBI Gene Symbol: LOC103326102 |
| Gene Aliases | |
| Gene description & Other designations | Description: phosphoenolpyruvate carboxylase; housekeeping isozyme Other designations: phosphoenolpyruvate carboxylase; housekeeping isozyme |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: minus Exon count: 11 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 11407433 ...... 11414160 |
| CDS Sequence | 103326102 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Di Repeat sequence: (AG)4 |
| Repeat start & end within CDS | Repeat start: 638 Repeat end: 645 |
| Forward primer | Primer sequence: CTGGTCCTCACTGCTCATCC Tm(°C): 59.822 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: TGGGGCATTATGGGGAACAC Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 498 End: 827 Product size (bp): 330 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103326102 NCBI Gene Symbol: LOC103326102 |
| Gene Aliases | |
| Gene description & Other designations | Description: phosphoenolpyruvate carboxylase; housekeeping isozyme Other designations: phosphoenolpyruvate carboxylase; housekeeping isozyme |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: minus Exon count: 11 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 11407433 ...... 11414160 |
| CDS Sequence | 103326102 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (TCCGTG)2 |
| Repeat start & end within CDS | Repeat start: 1001 Repeat end: 1012 |
| Forward primer | Primer sequence: GTCTATGTGGCGCTGCAATG Tm(°C): 59.971 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GGAATGTCAGAGTGCCCACA Tm(°C): 59.963 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 974 End: 1183 Product size (bp): 210 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103326102 NCBI Gene Symbol: LOC103326102 |
| Gene Aliases | |
| Gene description & Other designations | Description: phosphoenolpyruvate carboxylase; housekeeping isozyme Other designations: phosphoenolpyruvate carboxylase; housekeeping isozyme |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: minus Exon count: 11 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 11407433 ...... 11414160 |
| CDS Sequence | 103326102 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (GGCTC)2 |
| Repeat start & end within CDS | Repeat start: 1716 Repeat end: 1725 |
| Forward primer | Primer sequence: TGAGCTCCTGCAACGTGAAT Tm(°C): 59.965 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: CACCTCCCCTTCCAACAGTC Tm(°C): 59.963 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 1619 End: 1929 Product size (bp): 311 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103326102 NCBI Gene Symbol: LOC103326102 |
| Gene Aliases | |
| Gene description & Other designations | Description: phosphoenolpyruvate carboxylase; housekeeping isozyme Other designations: phosphoenolpyruvate carboxylase; housekeeping isozyme |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: minus Exon count: 11 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 11407433 ...... 11414160 |
| CDS Sequence | 103326102 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TGTTCCCCATAATGCCCCAC Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CGGAGTTCATCATTGCAGCG Tm(°C): 59.973 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 809 End: 1003 Product size (bp): 195 |
| JBrowse View | JBrowse |
