image


Statistics

Number of enzymes: 1
Total Number of designed primers: 8
Number of PGTM primers:     2
Number of PMTM primers:     6
Number of Failed designed PMTM primers: 1

Enzyme Id:  K01581

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111454396     NCBI Gene Symbol: LOC111454396
Gene Aliases
Gene description & Other designations Description:   ornithine decarboxylase-like      Other designations:   ornithine decarboxylase-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111454396
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (CAACCC)2
Repeat start & end within CDS Repeat start: 225     Repeat end: 236
Forward primer Primer sequence:   GCCCTCATGAACCTCTGGAC     Tm(°C): 60.107     GC (%): 60     Size: 20
Reverse primer Primer sequence:   CGGCGGCGAATTTGATATGG     Tm(°C): 60.11     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 162     End: 387     Product size (bp): 226
JBrowse View      JBrowse

Enzyme Id:  K01581

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111454396     NCBI Gene Symbol: LOC111454396
Gene Aliases
Gene description & Other designations Description:   ornithine decarboxylase-like      Other designations:   ornithine decarboxylase-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111454396
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CGC)3
Repeat start & end within CDS Repeat start: 381     Repeat end: 389
Forward primer Primer sequence:   GTCAAATGCAACCCCAACCC     Tm(°C): 59.965     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GCAATGCGCCGTATTTCTGT     Tm(°C): 59.901     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 216     End: 537     Product size (bp): 322
JBrowse View      JBrowse

Enzyme Id:  K01581

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111454396     NCBI Gene Symbol: LOC111454396
Gene Aliases
Gene description & Other designations Description:   ornithine decarboxylase-like      Other designations:   ornithine decarboxylase-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111454396
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CGG)3
Repeat start & end within CDS Repeat start: 723     Repeat end: 731
Forward primer Primer sequence:   CCGTCGTTGGCGTTTCTTTT     Tm(°C): 59.972     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GATATTCAGCTCCGCCGGAA     Tm(°C): 59.966     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 586     End: 815     Product size (bp): 230
JBrowse View      JBrowse

Enzyme Id:  K01581

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111454396     NCBI Gene Symbol: LOC111454396
Gene Aliases
Gene description & Other designations Description:   ornithine decarboxylase-like      Other designations:   ornithine decarboxylase-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111454396
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CGG)3
Repeat start & end within CDS Repeat start: 1157     Repeat end: 1165
Forward primer Primer sequence:   TACTGTACGATCACGCGACG     Tm(°C): 59.975     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCGCCGTGTTAAACCCATTG     Tm(°C): 60.11     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 952     End: 1197     Product size (bp): 246
JBrowse View      JBrowse

Enzyme Id:  K01581

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111454396     NCBI Gene Symbol: LOC111454396
Gene Aliases
Gene description & Other designations Description:   ornithine decarboxylase-like      Other designations:   ornithine decarboxylase-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111454396
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CCT)3
Repeat start & end within CDS Repeat start: 15     Repeat end: 23
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K01581

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111454396     NCBI Gene Symbol: LOC111454396
Gene Aliases
Gene description & Other designations Description:   ornithine decarboxylase-like      Other designations:   ornithine decarboxylase-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111454396
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CCGTCGTTGGCGTTTCTTTT     Tm(°C): 59.972     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CGTCGCGTGATCGTACAGTA     Tm(°C): 59.975     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 586     End: 971     Product size (bp): 386
JBrowse View      JBrowse

Enzyme Id:  K01581

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111454516     NCBI Gene Symbol: LOC111454516
Gene Aliases
Gene description & Other designations Description:   ornithine decarboxylase-like      Other designations:   ornithine decarboxylase-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111454516
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TATCG)2
Repeat start & end within CDS Repeat start: 679     Repeat end: 688
Forward primer Primer sequence:   CCGAATGAGATAGTGCCGCT     Tm(°C): 59.967     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CAAACACGGCTTTGATGGCA     Tm(°C): 59.968     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 576     End: 714     Product size (bp): 139
JBrowse View      JBrowse

Enzyme Id:  K01581

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111454516     NCBI Gene Symbol: LOC111454516
Gene Aliases
Gene description & Other designations Description:   ornithine decarboxylase-like      Other designations:   ornithine decarboxylase-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111454516
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GTT)3
Repeat start & end within CDS Repeat start: 1167     Repeat end: 1175
Forward primer Primer sequence:   GAGATCGCCGGGAGTATTGG     Tm(°C): 60.038     GC (%): 60     Size: 20
Reverse primer Primer sequence:   GACCCAGTTGCTGACGTGTA     Tm(°C): 59.967     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 937     End: 1210     Product size (bp): 274
JBrowse View      JBrowse

Enzyme Id:  K01581

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111454516     NCBI Gene Symbol: LOC111454516
Gene Aliases
Gene description & Other designations Description:   ornithine decarboxylase-like      Other designations:   ornithine decarboxylase-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111454516
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GCTAGTCGAGCCGAAATCGA     Tm(°C): 59.971     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CAAACACGGCTTTGATGGCA     Tm(°C): 59.968     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 321     End: 714     Product size (bp): 394
JBrowse View      JBrowse