image


Statistics

Number of enzymes: 1
Total Number of designed primers: 56
Number of PGTM primers:     9
Number of PMTM primers:     47
Number of Failed designed PMTM primers: 3

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103338246     NCBI Gene Symbol: LOC103338246
Gene Aliases
Gene description & Other designations Description:   ATPase 11; plasma membrane-type      Other designations:   ATPase 11; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG7     Strand:   minus     Exon count:   22
Gene Location within genomic sequence Genomic accession No. NC_024132.1      Gene Start and end within genomic accession: 13353446 ...... 13359747
CDS Sequence 103338246
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GCT)3
Repeat start & end within CDS Repeat start: 235     Repeat end: 243
Forward primer Primer sequence:   CAGTGAGGCTGCTGAGGAAA     Tm(°C): 59.964     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GCCTCTTGCTCATTCCACCT     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 113     End: 445     Product size (bp): 333
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103338246     NCBI Gene Symbol: LOC103338246
Gene Aliases
Gene description & Other designations Description:   ATPase 11; plasma membrane-type      Other designations:   ATPase 11; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG7     Strand:   minus     Exon count:   22
Gene Location within genomic sequence Genomic accession No. NC_024132.1      Gene Start and end within genomic accession: 13353446 ...... 13359747
CDS Sequence 103338246
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GCA)3
Repeat start & end within CDS Repeat start: 373     Repeat end: 381
Forward primer Primer sequence:   CCTCCCGACTGGCAAGATTT     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GCCTCTTGCTCATTCCACCT     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 279     End: 445     Product size (bp): 167
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103338246     NCBI Gene Symbol: LOC103338246
Gene Aliases
Gene description & Other designations Description:   ATPase 11; plasma membrane-type      Other designations:   ATPase 11; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG7     Strand:   minus     Exon count:   22
Gene Location within genomic sequence Genomic accession No. NC_024132.1      Gene Start and end within genomic accession: 13353446 ...... 13359747
CDS Sequence 103338246
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AGGAA)2
Repeat start & end within CDS Repeat start: 1563     Repeat end: 1572
Forward primer Primer sequence:   GGTGCACCAGAGCAGATTCT     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CATGTTGGTTCCCATCCCCA     Tm(°C): 59.959     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1281     End: 1604     Product size (bp): 324
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103338246     NCBI Gene Symbol: LOC103338246
Gene Aliases
Gene description & Other designations Description:   ATPase 11; plasma membrane-type      Other designations:   ATPase 11; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG7     Strand:   minus     Exon count:   22
Gene Location within genomic sequence Genomic accession No. NC_024132.1      Gene Start and end within genomic accession: 13353446 ...... 13359747
CDS Sequence 103338246
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AGGAC)2
Repeat start & end within CDS Repeat start: 1626     Repeat end: 1635
Forward primer Primer sequence:   CACCTAGGCATGACAGTGCA     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AAAACACCAGCAAAGCCGTC     Tm(°C): 59.898     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1474     End: 1705     Product size (bp): 232
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103338246     NCBI Gene Symbol: LOC103338246
Gene Aliases
Gene description & Other designations Description:   ATPase 11; plasma membrane-type      Other designations:   ATPase 11; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG7     Strand:   minus     Exon count:   22
Gene Location within genomic sequence Genomic accession No. NC_024132.1      Gene Start and end within genomic accession: 13353446 ...... 13359747
CDS Sequence 103338246
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CCTCCCGACTGGCAAGATTT     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GCCTCTTGCTCATTCCACCT     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 279     End: 445     Product size (bp): 167
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103341225     NCBI Gene Symbol: LOC103341225
Gene Aliases
Gene description & Other designations Description:   ATPase 8; plasma membrane-type      Other designations:   ATPase 8; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   minus     Exon count:   14
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 16530898 ...... 16535919
CDS Sequence 103341225
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TCAAC)2
Repeat start & end within CDS Repeat start: 320     Repeat end: 329
Forward primer Primer sequence:   AGAAGCGGCTGCAGATCTTT     Tm(°C): 60.036     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TCTCCCCACTTTCCATCCCT     Tm(°C): 59.879     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 121     End: 430     Product size (bp): 310
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103341225     NCBI Gene Symbol: LOC103341225
Gene Aliases
Gene description & Other designations Description:   ATPase 8; plasma membrane-type      Other designations:   ATPase 8; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   minus     Exon count:   14
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 16530898 ...... 16535919
CDS Sequence 103341225
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TGCCA)2
Repeat start & end within CDS Repeat start: 867     Repeat end: 876
Forward primer Primer sequence:   CGCAACTGGTGTCCATACCT     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACCCAATAGCCATGGTCACG     Tm(°C): 60.107     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 641     End: 906     Product size (bp): 266
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103341225     NCBI Gene Symbol: LOC103341225
Gene Aliases
Gene description & Other designations Description:   ATPase 8; plasma membrane-type      Other designations:   ATPase 8; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   minus     Exon count:   14
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 16530898 ...... 16535919
CDS Sequence 103341225
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GAA)3
Repeat start & end within CDS Repeat start: 1323     Repeat end: 1331
Forward primer Primer sequence:   AGCAGGAATCACTGAGGTGC     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GTCATGCCTTGGAGGGTCAA     Tm(°C): 59.962     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1172     End: 1481     Product size (bp): 310
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103341225     NCBI Gene Symbol: LOC103341225
Gene Aliases
Gene description & Other designations Description:   ATPase 8; plasma membrane-type      Other designations:   ATPase 8; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   minus     Exon count:   14
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 16530898 ...... 16535919
CDS Sequence 103341225
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TCT)3
Repeat start & end within CDS Repeat start: 2183     Repeat end: 2191
Forward primer Primer sequence:   TGCTGGGATTCATGCTCGTT     Tm(°C): 60.035     GC (%): 50     Size: 20
Reverse primer Primer sequence:   AGCGCTTGACTGATGATGCT     Tm(°C): 60.108     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1975     End: 2308     Product size (bp): 334
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103341225     NCBI Gene Symbol: LOC103341225
Gene Aliases
Gene description & Other designations Description:   ATPase 8; plasma membrane-type      Other designations:   ATPase 8; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   minus     Exon count:   14
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 16530898 ...... 16535919
CDS Sequence 103341225
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TTCAC)2
Repeat start & end within CDS Repeat start: 2646     Repeat end: 2655
Forward primer Primer sequence:   TTCTTGAACGCCCTGGTCTC     Tm(°C): 59.965     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGGAAACAACGCTCCTGGAG     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 2341     End: 2684     Product size (bp): 344
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103341225     NCBI Gene Symbol: LOC103341225
Gene Aliases
Gene description & Other designations Description:   ATPase 8; plasma membrane-type      Other designations:   ATPase 8; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   minus     Exon count:   14
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 16530898 ...... 16535919
CDS Sequence 103341225
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (ACACT)2
Repeat start & end within CDS Repeat start: 2829     Repeat end: 2838
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103341225     NCBI Gene Symbol: LOC103341225
Gene Aliases
Gene description & Other designations Description:   ATPase 8; plasma membrane-type      Other designations:   ATPase 8; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   minus     Exon count:   14
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 16530898 ...... 16535919
CDS Sequence 103341225
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GAAAAGGCCGATGGATTCGC     Tm(°C): 59.971     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ATCCTCTGGAAGATGGCCCT     Tm(°C): 60.029     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1671     End: 1930     Product size (bp): 260
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103328145     NCBI Gene Symbol: LOC103328145
Gene Aliases
Gene description & Other designations Description:   ATPase 9; plasma membrane-type      Other designations:   ATPase 9; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   15
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 6404123 ...... 6409186
CDS Sequence 103328145
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (TCAAC)2gataagctttat(AGA)3caatgcaggcaatgct(GCA)3
Repeat start & end within CDS Repeat start: 329     Repeat end: 384
Forward primer Primer sequence:   GCAGCTATCATGGCCATTGC     Tm(°C): 60.039     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GCCATCCAAGAGACGAGCAT     Tm(°C): 60.179     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 240     End: 527     Product size (bp): 288
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103328145     NCBI Gene Symbol: LOC103328145
Gene Aliases
Gene description & Other designations Description:   ATPase 9; plasma membrane-type      Other designations:   ATPase 9; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   15
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 6404123 ...... 6409186
CDS Sequence 103328145
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GGGAT)2
Repeat start & end within CDS Repeat start: 827     Repeat end: 836
Forward primer Primer sequence:   ACCTGGTTGACAGCACCAAA     Tm(°C): 60.034     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TCATCCTCTTCGTGATGGCG     Tm(°C): 59.897     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 688     End: 957     Product size (bp): 270
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103328145     NCBI Gene Symbol: LOC103328145
Gene Aliases
Gene description & Other designations Description:   ATPase 9; plasma membrane-type      Other designations:   ATPase 9; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   15
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 6404123 ...... 6409186
CDS Sequence 103328145
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CTT)3
Repeat start & end within CDS Repeat start: 1613     Repeat end: 1621
Forward primer Primer sequence:   GACAGACTGTGCCCGAGAAA     Tm(°C): 59.966     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CTCTTGCAGCCTCCTGACAA     Tm(°C): 59.964     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1399     End: 1748     Product size (bp): 350
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103328145     NCBI Gene Symbol: LOC103328145
Gene Aliases
Gene description & Other designations Description:   ATPase 9; plasma membrane-type      Other designations:   ATPase 9; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   15
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 6404123 ...... 6409186
CDS Sequence 103328145
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (GGATGG)2
Repeat start & end within CDS Repeat start: 2461     Repeat end: 2472
Forward primer Primer sequence:   TGTTTATGCACACTGGGGCT     Tm(°C): 59.888     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CTAGCAACTTCAGCTCGCCT     Tm(°C): 60.108     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 2420     End: 2767     Product size (bp): 348
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103328145     NCBI Gene Symbol: LOC103328145
Gene Aliases
Gene description & Other designations Description:   ATPase 9; plasma membrane-type      Other designations:   ATPase 9; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   15
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 6404123 ...... 6409186
CDS Sequence 103328145
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GACAGACTGTGCCCGAGAAA     Tm(°C): 59.966     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACCAATGGCTAGCTGGTCAC     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1399     End: 1568     Product size (bp): 170
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103329964     NCBI Gene Symbol: LOC103329964
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 1-like      Other designations:   plasma membrane ATPase 1-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   21
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 21647467 ...... 21653207
CDS Sequence 103329964
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GGA)3
Repeat start & end within CDS Repeat start: 277     Repeat end: 285
Forward primer Primer sequence:   CCCTCTGTCATGGGTGATGG     Tm(°C): 59.818     GC (%): 60     Size: 20
Reverse primer Primer sequence:   AATGGATGCGTCCTGCTCAA     Tm(°C): 60.035     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 221     End: 461     Product size (bp): 241
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103329964     NCBI Gene Symbol: LOC103329964
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 1-like      Other designations:   plasma membrane ATPase 1-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   21
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 21647467 ...... 21653207
CDS Sequence 103329964
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TGC)4
Repeat start & end within CDS Repeat start: 378     Repeat end: 389
Forward primer Primer sequence:   CCCTCTGTCATGGGTGATGG     Tm(°C): 59.818     GC (%): 60     Size: 20
Reverse primer Primer sequence:   AATGGATGCGTCCTGCTCAA     Tm(°C): 60.035     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 221     End: 461     Product size (bp): 241
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103329964     NCBI Gene Symbol: LOC103329964
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 1-like      Other designations:   plasma membrane ATPase 1-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   21
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 21647467 ...... 21653207
CDS Sequence 103329964
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CCTCT)2
Repeat start & end within CDS Repeat start: 2111     Repeat end: 2120
Forward primer Primer sequence:   AGCGTCATCATAAGTGCCGT     Tm(°C): 59.824     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TGTGCGAGGGAAGAAGTCTG     Tm(°C): 59.682     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1896     End: 2240     Product size (bp): 345
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103329964     NCBI Gene Symbol: LOC103329964
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 1-like      Other designations:   plasma membrane ATPase 1-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   21
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 21647467 ...... 21653207
CDS Sequence 103329964
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (GGGTGG)2
Repeat start & end within CDS Repeat start: 2479     Repeat end: 2490
Forward primer Primer sequence:   GCTACGTTGATCGCCGTCTA     Tm(°C): 59.971     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CTCCCGCTCAGAGCATATCG     Tm(°C): 60.109     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 2424     End: 2575     Product size (bp): 152
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103329964     NCBI Gene Symbol: LOC103329964
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 1-like      Other designations:   plasma membrane ATPase 1-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   21
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 21647467 ...... 21653207
CDS Sequence 103329964
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   AAGTGAGCACCGTCAGTCAG     Tm(°C): 59.967     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TAGACGGCGATCAACGTAGC     Tm(°C): 59.971     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 2311     End: 2443     Product size (bp): 133
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103331606     NCBI Gene Symbol: LOC103331606
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 1-like      Other designations:   plasma membrane ATPase 1-like
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   minus     Exon count:   22
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 13304867 ...... 13311628
CDS Sequence 103331606
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GCT)3
Repeat start & end within CDS Repeat start: 343     Repeat end: 351
Forward primer Primer sequence:   CCTGGGTTATGGAAGCTGCA     Tm(°C): 60.034     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GCAGGACCTTTGCTTTTGGG     Tm(°C): 59.966     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 190     End: 387     Product size (bp): 198
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103331606     NCBI Gene Symbol: LOC103331606
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 1-like      Other designations:   plasma membrane ATPase 1-like
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   minus     Exon count:   22
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 13304867 ...... 13311628
CDS Sequence 103331606
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AACAC)2
Repeat start & end within CDS Repeat start: 667     Repeat end: 676
Forward primer Primer sequence:   GGTGACGGGGTTTACTCAGG     Tm(°C): 60.037     GC (%): 60     Size: 20
Reverse primer Primer sequence:   CCAACACGGTATTCCCTCCC     Tm(°C): 60.107     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 558     End: 799     Product size (bp): 242
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103331606     NCBI Gene Symbol: LOC103331606
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 1-like      Other designations:   plasma membrane ATPase 1-like
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   minus     Exon count:   22
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 13304867 ...... 13311628
CDS Sequence 103331606
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (GACACT)2
Repeat start & end within CDS Repeat start: 978     Repeat end: 989
Forward primer Primer sequence:   CTCAGCAGGGTGCCATAACA     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CTTGCCTCCTTAGGGTCTGC     Tm(°C): 60.107     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 895     End: 1147     Product size (bp): 253
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103331606     NCBI Gene Symbol: LOC103331606
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 1-like      Other designations:   plasma membrane ATPase 1-like
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   minus     Exon count:   22
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 13304867 ...... 13311628
CDS Sequence 103331606
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CTAAA)2
Repeat start & end within CDS Repeat start: 2261     Repeat end: 2270
Forward primer Primer sequence:   CCGACAGTTGGAAGCTCAGT     Tm(°C): 59.966     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCGGGAGCGAGTGACAAATA     Tm(°C): 59.825     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 2083     End: 2345     Product size (bp): 263
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103331606     NCBI Gene Symbol: LOC103331606
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 1-like      Other designations:   plasma membrane ATPase 1-like
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   minus     Exon count:   22
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 13304867 ...... 13311628
CDS Sequence 103331606
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (ACACT)2
Repeat start & end within CDS Repeat start: 2853     Repeat end: 2862
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103331606     NCBI Gene Symbol: LOC103331606
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 1-like      Other designations:   plasma membrane ATPase 1-like
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   minus     Exon count:   22
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 13304867 ...... 13311628
CDS Sequence 103331606
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CCTGGGTTATGGAAGCTGCA     Tm(°C): 60.034     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GCAGGACCTTTGCTTTTGGG     Tm(°C): 59.966     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 190     End: 387     Product size (bp): 198
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103337045     NCBI Gene Symbol: LOC103337045
Gene Aliases
Gene description & Other designations Description:   ATPase 11; plasma membrane-type-like      Other designations:   ATPase 11; plasma membrane-type-like
Chromosome, Strand & Exon count Chromosome:   LG7     Strand:   plus     Exon count:   21
Gene Location within genomic sequence Genomic accession No. NC_024132.1      Gene Start and end within genomic accession: 4581766 ...... 4589246
CDS Sequence 103337045
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (TGCAGC)2
Repeat start & end within CDS Repeat start: 366     Repeat end: 377
Forward primer Primer sequence:   ATGACTTCGTGGGCATCCTG     Tm(°C): 60.108     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GTCTCCAGGAACCAGCACAG     Tm(°C): 60.321     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 289     End: 464     Product size (bp): 176
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103337045     NCBI Gene Symbol: LOC103337045
Gene Aliases
Gene description & Other designations Description:   ATPase 11; plasma membrane-type-like      Other designations:   ATPase 11; plasma membrane-type-like
Chromosome, Strand & Exon count Chromosome:   LG7     Strand:   plus     Exon count:   21
Gene Location within genomic sequence Genomic accession No. NC_024132.1      Gene Start and end within genomic accession: 4581766 ...... 4589246
CDS Sequence 103337045
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TCT)3
Repeat start & end within CDS Repeat start: 2397     Repeat end: 2405
Forward primer Primer sequence:   AAAGCTAGCATCTGCCGTGT     Tm(°C): 60.036     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TGGGTGTTGAAAGCCGTTCT     Tm(°C): 60.107     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 2297     End: 2632     Product size (bp): 336
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103337045     NCBI Gene Symbol: LOC103337045
Gene Aliases
Gene description & Other designations Description:   ATPase 11; plasma membrane-type-like      Other designations:   ATPase 11; plasma membrane-type-like
Chromosome, Strand & Exon count Chromosome:   LG7     Strand:   plus     Exon count:   21
Gene Location within genomic sequence Genomic accession No. NC_024132.1      Gene Start and end within genomic accession: 4581766 ...... 4589246
CDS Sequence 103337045
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TCGTTTAGCTCAGCAGGGTG     Tm(°C): 60.037     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGCAACAGCAAGGGATCGAA     Tm(°C): 59.963     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 911     End: 1388     Product size (bp): 478
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320092     NCBI Gene Symbol: LOC103320092
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 4      Other designations:   LOW QUALITY PROTEIN: plasma membrane ATPase 4
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 8837731 ...... 8844577
CDS Sequence 103320092
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (GCT)3ttgatggctatagccctggcaaa(TGG)3
Repeat start & end within CDS Repeat start: 238     Repeat end: 278
Forward primer Primer sequence:   ACCGGCTTCAAGTGTTTGGA     Tm(°C): 60.107     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CTTGCTCAGTCCATCGACCA     Tm(°C): 59.753     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 133     End: 444     Product size (bp): 312
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320092     NCBI Gene Symbol: LOC103320092
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 4      Other designations:   LOW QUALITY PROTEIN: plasma membrane ATPase 4
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 8837731 ...... 8844577
CDS Sequence 103320092
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (GGGAT)2tgacaatttgctggttctcttgattggaggaatcccaat(TGCCA)2
Repeat start & end within CDS Repeat start: 794     Repeat end: 852
Forward primer Primer sequence:   GCAGTTGTGATTGCCACTGG     Tm(°C): 60.039     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGTGGGAGCCAATAGCCATG     Tm(°C): 60.107     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 606     End: 888     Product size (bp): 283
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320092     NCBI Gene Symbol: LOC103320092
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 4      Other designations:   LOW QUALITY PROTEIN: plasma membrane ATPase 4
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 8837731 ...... 8844577
CDS Sequence 103320092
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (TGTGAA)2
Repeat start & end within CDS Repeat start: 1494     Repeat end: 1505
Forward primer Primer sequence:   GATCCTCCCAGGCATGACAG     Tm(°C): 59.892     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TTGTCTTGGCCAAGCAATGC     Tm(°C): 59.966     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1440     End: 1582     Product size (bp): 143
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320092     NCBI Gene Symbol: LOC103320092
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 4      Other designations:   LOW QUALITY PROTEIN: plasma membrane ATPase 4
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 8837731 ...... 8844577
CDS Sequence 103320092
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (ACTAT)2ctatgctgtttctattaccatacgtatagtgtttggatttatgtt(C
ATTG)2
Repeat start & end within CDS Repeat start: 1889     Repeat end: 1953
Forward primer Primer sequence:   ACTGATGCTGCTAGAGGTGC     Tm(°C): 59.822     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GGCTTCACTCGGTCCTTTGA     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1782     End: 2047     Product size (bp): 266
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320092     NCBI Gene Symbol: LOC103320092
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 4      Other designations:   LOW QUALITY PROTEIN: plasma membrane ATPase 4
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 8837731 ...... 8844577
CDS Sequence 103320092
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (TCT)3ggcttat(GA)4
Repeat start & end within CDS Repeat start: 2135     Repeat end: 2158
Forward primer Primer sequence:   TCAAAGGACCGAGTGAAGCC     Tm(°C): 59.965     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGGGTTGCTACCAGTTGAGC     Tm(°C): 59.963     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 2028     End: 2356     Product size (bp): 329
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320092     NCBI Gene Symbol: LOC103320092
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 4      Other designations:   LOW QUALITY PROTEIN: plasma membrane ATPase 4
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 8837731 ...... 8844577
CDS Sequence 103320092
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (GGCTGG)2(GGGCT)2*
Repeat start & end within CDS Repeat start: 2404     Repeat end: 2418
Forward primer Primer sequence:   GCTCAACTGGTAGCAACCCT     Tm(°C): 59.963     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AAGGCCATGTAGGGTCCTCT     Tm(°C): 59.955     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 2337     End: 2612     Product size (bp): 276
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320092     NCBI Gene Symbol: LOC103320092
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 4      Other designations:   LOW QUALITY PROTEIN: plasma membrane ATPase 4
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 8837731 ...... 8844577
CDS Sequence 103320092
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (GA)4agctcagtgg(GCT)3
Repeat start & end within CDS Repeat start: 2566     Repeat end: 2592
Forward primer Primer sequence:   GCTCAACTGGTAGCAACCCT     Tm(°C): 59.963     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AAGGCCATGTAGGGTCCTCT     Tm(°C): 59.955     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 2337     End: 2612     Product size (bp): 276
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320092     NCBI Gene Symbol: LOC103320092
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 4      Other designations:   LOW QUALITY PROTEIN: plasma membrane ATPase 4
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 8837731 ...... 8844577
CDS Sequence 103320092
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CAAGC)2
Repeat start & end within CDS Repeat start: 2683     Repeat end: 2692
Forward primer Primer sequence:   AGAGGACCCTACATGGCCTT     Tm(°C): 59.955     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGACCCTTCAGTGTGTGCAA     Tm(°C): 59.746     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 2593     End: 2740     Product size (bp): 148
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320092     NCBI Gene Symbol: LOC103320092
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 4      Other designations:   LOW QUALITY PROTEIN: plasma membrane ATPase 4
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 8837731 ...... 8844577
CDS Sequence 103320092
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (TCGACA)2
Repeat start & end within CDS Repeat start: 2771     Repeat end: 2782
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320092     NCBI Gene Symbol: LOC103320092
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 4      Other designations:   LOW QUALITY PROTEIN: plasma membrane ATPase 4
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 8837731 ...... 8844577
CDS Sequence 103320092
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GCATTGCTTGGCCAAGACAA     Tm(°C): 59.966     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GGCTTCACTCGGTCCTTTGA     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1563     End: 2047     Product size (bp): 485
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103323534     NCBI Gene Symbol: LOC103323534
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 4      Other designations:   plasma membrane ATPase 4
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 35814356 ...... 35821394
CDS Sequence 103323534
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AGAAG)2
Repeat start & end within CDS Repeat start: 168     Repeat end: 177
Forward primer Primer sequence:   GACTGTTGATCTGGAGCGGA     Tm(°C): 59.467     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GGTGGAGTTGATGACCAGCA     Tm(°C): 59.963     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 47     End: 341     Product size (bp): 295
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103323534     NCBI Gene Symbol: LOC103323534
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 4      Other designations:   plasma membrane ATPase 4
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 35814356 ...... 35821394
CDS Sequence 103323534
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TGTCT)2
Repeat start & end within CDS Repeat start: 891     Repeat end: 900
Forward primer Primer sequence:   CGTGGACAGCACAAACCAAG     Tm(°C): 59.971     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACTGCAAAGCACATCCATGC     Tm(°C): 59.754     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 695     End: 1001     Product size (bp): 307
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103323534     NCBI Gene Symbol: LOC103323534
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 4      Other designations:   plasma membrane ATPase 4
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 35814356 ...... 35821394
CDS Sequence 103323534
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (TGATGG)2
Repeat start & end within CDS Repeat start: 1254     Repeat end: 1265
Forward primer Primer sequence:   AGGCCCGAGCTGGTATTAGA     Tm(°C): 60.106     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AACAAATTGCCATGGACCGC     Tm(°C): 60.037     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1177     End: 1457     Product size (bp): 281
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103323534     NCBI Gene Symbol: LOC103323534
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 4      Other designations:   plasma membrane ATPase 4
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 35814356 ...... 35821394
CDS Sequence 103323534
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (AAG)3
Repeat start & end within CDS Repeat start: 1336     Repeat end: 1344
Forward primer Primer sequence:   AGGCCCGAGCTGGTATTAGA     Tm(°C): 60.106     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AACAAATTGCCATGGACCGC     Tm(°C): 60.037     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1177     End: 1457     Product size (bp): 281
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103323534     NCBI Gene Symbol: LOC103323534
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 4      Other designations:   plasma membrane ATPase 4
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 35814356 ...... 35821394
CDS Sequence 103323534
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (TGTTAA)2gatgattacaggtgatcaac(TTGCCA)2
Repeat start & end within CDS Repeat start: 1530     Repeat end: 1573
Forward primer Primer sequence:   GCGGTCCATGGCAATTTGTT     Tm(°C): 60.037     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GCTTGCATCCTTGTCTTGGC     Tm(°C): 60.109     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1438     End: 1652     Product size (bp): 215
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103323534     NCBI Gene Symbol: LOC103323534
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 4      Other designations:   plasma membrane ATPase 4
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 35814356 ...... 35821394
CDS Sequence 103323534
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (TTGCTG)2
Repeat start & end within CDS Repeat start: 1826     Repeat end: 1837
Forward primer Primer sequence:   GCCATTGCCAAGGAAACTGG     Tm(°C): 60.037     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACAATGTCGGAAGCACCTCG     Tm(°C): 60.671     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1563     End: 1873     Product size (bp): 311
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103323534     NCBI Gene Symbol: LOC103323534
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 4      Other designations:   plasma membrane ATPase 4
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 35814356 ...... 35821394
CDS Sequence 103323534
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TCT)3
Repeat start & end within CDS Repeat start: 2195     Repeat end: 2203
Forward primer Primer sequence:   GCCATCACCCTTGCCTGATA     Tm(°C): 59.817     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CGTTCAAGGAAGGACCAGCT     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 2105     End: 2362     Product size (bp): 258
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103323534     NCBI Gene Symbol: LOC103323534
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 4      Other designations:   plasma membrane ATPase 4
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 35814356 ...... 35821394
CDS Sequence 103323534
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (AG)4
Repeat start & end within CDS Repeat start: 2257     Repeat end: 2264
Forward primer Primer sequence:   GCCATCACCCTTGCCTGATA     Tm(°C): 59.817     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CGTTCAAGGAAGGACCAGCT     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 2105     End: 2362     Product size (bp): 258
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103323534     NCBI Gene Symbol: LOC103323534
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 4      Other designations:   plasma membrane ATPase 4
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 35814356 ...... 35821394
CDS Sequence 103323534
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (GA)4
Repeat start & end within CDS Repeat start: 2626     Repeat end: 2633
Forward primer Primer sequence:   AGCTGGTCCTTCCTTGAACG     Tm(°C): 59.965     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGGGTCCTTTGAGCAAGAGC     Tm(°C): 59.963     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 2343     End: 2662     Product size (bp): 320
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103323534     NCBI Gene Symbol: LOC103323534
Gene Aliases
Gene description & Other designations Description:   plasma membrane ATPase 4      Other designations:   plasma membrane ATPase 4
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 35814356 ...... 35821394
CDS Sequence 103323534
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CGTGGACAGCACAAACCAAG     Tm(°C): 59.971     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGACAAGACAGTGGGCATGG     Tm(°C): 59.963     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 695     End: 899     Product size (bp): 205
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327538     NCBI Gene Symbol: LOC103327538
Gene Aliases
Gene description & Other designations Description:   ATPase 10; plasma membrane-type      Other designations:   ATPase 10; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   22
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 2069631 ...... 2076315
CDS Sequence 103327538
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GAAGA)2
Repeat start & end within CDS Repeat start: 175     Repeat end: 184
Forward primer Primer sequence:   AGGTGTCGATTTGGAACGCT     Tm(°C): 59.965     GC (%): 50     Size: 20
Reverse primer Primer sequence:   ATCACTGCTGCAGCTTCCAT     Tm(°C): 60.034     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 53     End: 259     Product size (bp): 207
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327538     NCBI Gene Symbol: LOC103327538
Gene Aliases
Gene description & Other designations Description:   ATPase 10; plasma membrane-type      Other designations:   ATPase 10; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   22
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 2069631 ...... 2076315
CDS Sequence 103327538
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (GCAAGA)2
Repeat start & end within CDS Repeat start: 444     Repeat end: 455
Forward primer Primer sequence:   CATCGGCTCTTATGGCTCGT     Tm(°C): 59.967     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GGGTCTCCTTCAAGTAGGCG     Tm(°C): 59.824     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 385     End: 541     Product size (bp): 157
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327538     NCBI Gene Symbol: LOC103327538
Gene Aliases
Gene description & Other designations Description:   ATPase 10; plasma membrane-type      Other designations:   ATPase 10; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   22
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 2069631 ...... 2076315
CDS Sequence 103327538
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GGGAT)2
Repeat start & end within CDS Repeat start: 836     Repeat end: 845
Forward primer Primer sequence:   ATGTTCCCCATACAGCACCG     Tm(°C): 60.107     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GGCACCCTGTTGAGAGAGTC     Tm(°C): 60.037     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 807     End: 950     Product size (bp): 144
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327538     NCBI Gene Symbol: LOC103327538
Gene Aliases
Gene description & Other designations Description:   ATPase 10; plasma membrane-type      Other designations:   ATPase 10; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   22
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 2069631 ...... 2076315
CDS Sequence 103327538
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (TGGGA)2acaaacatgtacccttcctcttcattgttggg(CCGTGA)2
Repeat start & end within CDS Repeat start: 1599     Repeat end: 1652
Forward primer Primer sequence:   ACGTTTTGTGGGTTGTTGCC     Tm(°C): 60.109     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CCACTGGAAGAGCTTCGTGT     Tm(°C): 59.966     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1455     End: 1680     Product size (bp): 226
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327538     NCBI Gene Symbol: LOC103327538
Gene Aliases
Gene description & Other designations Description:   ATPase 10; plasma membrane-type      Other designations:   ATPase 10; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   22
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 2069631 ...... 2076315
CDS Sequence 103327538
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AAGAA)2
Repeat start & end within CDS Repeat start: 1757     Repeat end: 1766
Forward primer Primer sequence:   GCTTTGCTGGAGTCTTCCCT     Tm(°C): 59.963     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CGCAAGAAGCACGAAACCAA     Tm(°C): 59.971     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1705     End: 2018     Product size (bp): 314
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327538     NCBI Gene Symbol: LOC103327538
Gene Aliases
Gene description & Other designations Description:   ATPase 10; plasma membrane-type      Other designations:   ATPase 10; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   22
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 2069631 ...... 2076315
CDS Sequence 103327538
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (GGATGG)2
Repeat start & end within CDS Repeat start: 2470     Repeat end: 2481
Forward primer Primer sequence:   TTTCTTGAGAGGCCCGGAAC     Tm(°C): 59.964     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CTCAAGCCGTAGCGAATTGC     Tm(°C): 59.973     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 2358     End: 2560     Product size (bp): 203
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327538     NCBI Gene Symbol: LOC103327538
Gene Aliases
Gene description & Other designations Description:   ATPase 10; plasma membrane-type      Other designations:   ATPase 10; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   22
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 2069631 ...... 2076315
CDS Sequence 103327538
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CAGGC)2
Repeat start & end within CDS Repeat start: 2731     Repeat end: 2740
Forward primer Primer sequence:   GCAATTCGCTACGGCTTGAG     Tm(°C): 59.973     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCTCTCCCAGCCTGGCTATT     Tm(°C): 60.031     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 2541     End: 2769     Product size (bp): 229
JBrowse View      JBrowse

Enzyme Id:  K01535
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327538     NCBI Gene Symbol: LOC103327538
Gene Aliases
Gene description & Other designations Description:   ATPase 10; plasma membrane-type      Other designations:   ATPase 10; plasma membrane-type
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   22
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 2069631 ...... 2076315
CDS Sequence 103327538
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GCAATTCGCTACGGCTTGAG     Tm(°C): 59.973     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCTCTCCCAGCCTGGCTATT     Tm(°C): 60.031     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 2541     End: 2769     Product size (bp): 229
JBrowse View      JBrowse