image


Statistics

Number of enzymes: 1
Total Number of designed primers: 11
Number of PGTM primers:     5
Number of PMTM primers:     6

Enzyme Id:  K01507
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103339904     NCBI Gene Symbol: LOC103339904
Gene Aliases
Gene description & Other designations Description:   soluble inorganic pyrophosphatase 4      Other designations:   soluble inorganic pyrophosphatase 4
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   minus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 21319462 ...... 21323482
CDS Sequence 103339904
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CAT)6
Repeat start & end within CDS Repeat start: 61     Repeat end: 78
Forward primer Primer sequence:   GGCTCCACCAATTGAGACTGT     Tm(°C): 60.272     GC (%): 52.381     Size: 21
Reverse primer Primer sequence:   GCCAAGGGTGTGCAGCTATA     Tm(°C): 60.107     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 2     End: 150     Product size (bp): 149
JBrowse View      JBrowse

Enzyme Id:  K01507
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103339904     NCBI Gene Symbol: LOC103339904
Gene Aliases
Gene description & Other designations Description:   soluble inorganic pyrophosphatase 4      Other designations:   soluble inorganic pyrophosphatase 4
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   minus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 21319462 ...... 21323482
CDS Sequence 103339904
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TATAGCTGCACACCCTTGGC     Tm(°C): 60.107     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCAAACGATGTGGTGGGAGA     Tm(°C): 59.964     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 131     End: 528     Product size (bp): 398
JBrowse View      JBrowse

Enzyme Id:  K01507
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103340111     NCBI Gene Symbol: LOC103340111
Gene Aliases
Gene description & Other designations Description:   soluble inorganic pyrophosphatase      Other designations:   soluble inorganic pyrophosphatase
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   plus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 11035176 ...... 11038769
CDS Sequence 103340111
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GACAA)2
Repeat start & end within CDS Repeat start: 202     Repeat end: 211
Forward primer Primer sequence:   TGGTGGAGAAGGGAGTGGAA     Tm(°C): 60.105     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GAACCAGGTAAGACGGGCTC     Tm(°C): 60.108     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 11     End: 352     Product size (bp): 342
JBrowse View      JBrowse

Enzyme Id:  K01507
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103340111     NCBI Gene Symbol: LOC103340111
Gene Aliases
Gene description & Other designations Description:   soluble inorganic pyrophosphatase      Other designations:   soluble inorganic pyrophosphatase
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   plus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 11035176 ...... 11038769
CDS Sequence 103340111
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (GTACTG)2atgcaggagcccgtcttacctgg(TTCTT)2(TCGTGC)2*
Repeat start & end within CDS Repeat start: 316     Repeat end: 371
Forward primer Primer sequence:   TCGACAAGACAACTGGCCTC     Tm(°C): 59.966     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGTCCTTGGTGTAGCGGAAC     Tm(°C): 59.966     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 199     End: 465     Product size (bp): 267
JBrowse View      JBrowse

Enzyme Id:  K01507
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103340111     NCBI Gene Symbol: LOC103340111
Gene Aliases
Gene description & Other designations Description:   soluble inorganic pyrophosphatase      Other designations:   soluble inorganic pyrophosphatase
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   plus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 11035176 ...... 11038769
CDS Sequence 103340111
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TCGACAAGACAACTGGCCTC     Tm(°C): 59.966     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGTCCTTGGTGTAGCGGAAC     Tm(°C): 59.966     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 199     End: 465     Product size (bp): 267
JBrowse View      JBrowse

Enzyme Id:  K01507
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103342348     NCBI Gene Symbol: LOC103342348
Gene Aliases
Gene description & Other designations Description:   soluble inorganic pyrophosphatase 1      Other designations:   soluble inorganic pyrophosphatase 1
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 103342348
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GTT)3
Repeat start & end within CDS Repeat start: 145     Repeat end: 153
Forward primer Primer sequence:   ACTGCACCCCACCTTTTCAA     Tm(°C): 60.033     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GCTCGCAGAAAACAACCAGG     Tm(°C): 60.04     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 123     End: 352     Product size (bp): 230
JBrowse View      JBrowse

Enzyme Id:  K01507
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103342348     NCBI Gene Symbol: LOC103342348
Gene Aliases
Gene description & Other designations Description:   soluble inorganic pyrophosphatase 1      Other designations:   soluble inorganic pyrophosphatase 1
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 103342348
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (GAGCCA)2
Repeat start & end within CDS Repeat start: 350     Repeat end: 361
Forward primer Primer sequence:   ACTGCACCCCACCTTTTCAA     Tm(°C): 60.033     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TCTGGATCATCAGCGCAGAC     Tm(°C): 59.896     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 123     End: 433     Product size (bp): 311
JBrowse View      JBrowse

Enzyme Id:  K01507
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103342348     NCBI Gene Symbol: LOC103342348
Gene Aliases
Gene description & Other designations Description:   soluble inorganic pyrophosphatase 1      Other designations:   soluble inorganic pyrophosphatase 1
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 103342348
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   ACTGCACCCCACCTTTTCAA     Tm(°C): 60.033     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GCTCGCAGAAAACAACCAGG     Tm(°C): 60.04     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 123     End: 352     Product size (bp): 230
JBrowse View      JBrowse

Enzyme Id:  K01507
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335820     NCBI Gene Symbol: LOC103335820
Gene Aliases
Gene description & Other designations Description:   soluble inorganic pyrophosphatase 6; chloroplastic      Other designations:   soluble inorganic pyrophosphatase 6; chloroplastic|soluble inorganic pyrophosphatase 1; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG6     Strand:   plus     Exon count:   6
Gene Location within genomic sequence Genomic accession No. NC_024131.1      Gene Start and end within genomic accession: 12191452 ...... 12203156
CDS Sequence 103335820
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (AGA)3gcac(CGT)3
Repeat start & end within CDS Repeat start: 109     Repeat end: 130
Forward primer Primer sequence:   TTGCTCTCCAAGACGACGTC     Tm(°C): 60.039     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCAACACGGTCGAGGAAGAA     Tm(°C): 59.967     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 42     End: 250     Product size (bp): 209
JBrowse View      JBrowse

Enzyme Id:  K01507
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335820     NCBI Gene Symbol: LOC103335820
Gene Aliases
Gene description & Other designations Description:   soluble inorganic pyrophosphatase 6; chloroplastic      Other designations:   soluble inorganic pyrophosphatase 6; chloroplastic|soluble inorganic pyrophosphatase 1; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG6     Strand:   plus     Exon count:   6
Gene Location within genomic sequence Genomic accession No. NC_024131.1      Gene Start and end within genomic accession: 12191452 ...... 12203156
CDS Sequence 103335820
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TTCTTCCTCGACCGTGTTGG     Tm(°C): 59.967     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGAGAGTCCCCGGAAAATGC     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 231     End: 711     Product size (bp): 481
JBrowse View      JBrowse

Enzyme Id:  K01507
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103342349     NCBI Gene Symbol: LOC103342349
Gene Aliases
Gene description & Other designations Description:   soluble inorganic pyrophosphatase 1-like      Other designations:   soluble inorganic pyrophosphatase 1-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 103342349
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TGTTTTCTGCGAGCCAAAGC     Tm(°C): 59.969     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CGCATTGTGGGAAGGCAAAA     Tm(°C): 59.967     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 348     End: 575     Product size (bp): 228
JBrowse View      JBrowse