|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 111430799 NCBI Gene Symbol: LOC111430799 |
Gene Aliases | |
Gene description & Other designations | Description: proline iminopeptidase Other designations: proline iminopeptidase |
Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
CDS Sequence | 111430799 |
| Marker Information | |
Marker Type | PGTM |
Repeat type & sequence | Repeat type: Repeat sequence: |
Repeat start & end within CDS | Repeat start: Repeat end: |
Forward primer | Primer sequence: CCCGTCTCTCGTGTTTCCAA Tm(°C): 59.967 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: CAGCCATCAAGTCCTTCCGT Tm(°C): 60.036 GC (%): 55 Size: 20 |
Primer start, end within sequence and product size | Start: 96 End: 216 Product size (bp): 121 |
JBrowse View | JBrowse |