|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103322886 NCBI Gene Symbol: LOC103322886 |
| Gene Aliases | |
| Gene description & Other designations | Description: pyruvate; phosphate dikinase; chloroplastic Other designations: pyruvate; phosphate dikinase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: LG2 Strand: plus Exon count: 22 |
| Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 30620307 ...... 30627199 |
| CDS Sequence | 103322886 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (ACAAAG)2 |
| Repeat start & end within CDS | Repeat start: 1481 Repeat end: 1492 |
| Forward primer | Primer sequence: AACCACAGCACCTTGACCAA Tm(°C): 60.034 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: TGTCAAGATCCCAGCAGCTG Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 1426 End: 1661 Product size (bp): 236 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103322886 NCBI Gene Symbol: LOC103322886 |
| Gene Aliases | |
| Gene description & Other designations | Description: pyruvate; phosphate dikinase; chloroplastic Other designations: pyruvate; phosphate dikinase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: LG2 Strand: plus Exon count: 22 |
| Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 30620307 ...... 30627199 |
| CDS Sequence | 103322886 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (AGACT)2atgtttcgtgttctccattcagggtacctatt(GCTAG)2(AGC)3* |
| Repeat start & end within CDS | Repeat start: 2869 Repeat end: 2927 |
| Forward primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Reverse primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Primer start, end within sequence and product size | Start: End: Product size (bp): |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103322886 NCBI Gene Symbol: LOC103322886 |
| Gene Aliases | |
| Gene description & Other designations | Description: pyruvate; phosphate dikinase; chloroplastic Other designations: pyruvate; phosphate dikinase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: LG2 Strand: plus Exon count: 22 |
| Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 30620307 ...... 30627199 |
| CDS Sequence | 103322886 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GAAAGGTGCAAACCTGGCAG Tm(°C): 59.967 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CCACTCTTTGCAGCCAAACC Tm(°C): 59.967 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 389 End: 697 Product size (bp): 309 |
| JBrowse View | JBrowse |
