image


Statistics

Number of enzymes: 1
Total Number of designed primers: 34
Number of PGTM primers:     9
Number of PMTM primers:     25
Number of Failed designed PMTM primers: 1

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103339759     NCBI Gene Symbol: LOC103339759
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase 1; cytosolic      Other designations:   pyruvate kinase 1; cytosolic
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   plus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 8844216 ...... 8850468
CDS Sequence 103339759
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (CT)4gctcaagataaggaagttataagcagttggggactt(CAAAA)2
Repeat start & end within CDS Repeat start: 608     Repeat end: 661
Forward primer Primer sequence:   TTGTCGGCCAGTACCTGTTC     Tm(°C): 59.966     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CGAACATCTTCTGCATGCCG     Tm(°C): 59.973     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 445     End: 706     Product size (bp): 262
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103339759     NCBI Gene Symbol: LOC103339759
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase 1; cytosolic      Other designations:   pyruvate kinase 1; cytosolic
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   plus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 8844216 ...... 8850468
CDS Sequence 103339759
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (TGT)3tcctcggctcaagactaatcaacttaaatggagctttactggagccttt
g(AGGCA)2
Repeat start & end within CDS Repeat start: 1311     Repeat end: 1379
Forward primer Primer sequence:   CTTCAGGAAGGGCTGCAAGA     Tm(°C): 59.963     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CGACAGAGGCATCACCAACT     Tm(°C): 60.037     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1252     End: 1557     Product size (bp): 306
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103339759     NCBI Gene Symbol: LOC103339759
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase 1; cytosolic      Other designations:   pyruvate kinase 1; cytosolic
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   plus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 8844216 ...... 8850468
CDS Sequence 103339759
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TTGTCGGCCAGTACCTGTTC     Tm(°C): 59.966     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CGAACATCTTCTGCATGCCG     Tm(°C): 59.973     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 445     End: 706     Product size (bp): 262
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103331201     NCBI Gene Symbol: LOC103331201
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase 1; cytosolic-like      Other designations:   pyruvate kinase 1; cytosolic-like
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   plus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 9126346 ...... 9137988
CDS Sequence 103331201
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GATTT)2
Repeat start & end within CDS Repeat start: 173     Repeat end: 182
Forward primer Primer sequence:   TCACTTGCTTCTGGAGGAGC     Tm(°C): 59.677     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACGGGGCGCTCAGATTTATT     Tm(°C): 59.82     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 11     End: 322     Product size (bp): 312
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103331201     NCBI Gene Symbol: LOC103331201
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase 1; cytosolic-like      Other designations:   pyruvate kinase 1; cytosolic-like
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   plus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 9126346 ...... 9137988
CDS Sequence 103331201
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (AGATAA)2
Repeat start & end within CDS Repeat start: 615     Repeat end: 626
Forward primer Primer sequence:   GCTACCTTGTCAGGGCCATT     Tm(°C): 60.034     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GCCCCAAGTGCTTATGACCT     Tm(°C): 60.034     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 546     End: 647     Product size (bp): 102
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103331201     NCBI Gene Symbol: LOC103331201
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase 1; cytosolic-like      Other designations:   pyruvate kinase 1; cytosolic-like
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   plus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 9126346 ...... 9137988
CDS Sequence 103331201
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (GCTGAG)2
Repeat start & end within CDS Repeat start: 1102     Repeat end: 1113
Forward primer Primer sequence:   TCTAGGTGCGGAGACCCTAC     Tm(°C): 60.107     GC (%): 60     Size: 20
Reverse primer Primer sequence:   GCACAGGCATTGTTGGTCTG     Tm(°C): 60.039     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1034     End: 1305     Product size (bp): 272
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103331201     NCBI Gene Symbol: LOC103331201
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase 1; cytosolic-like      Other designations:   pyruvate kinase 1; cytosolic-like
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   plus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 9126346 ...... 9137988
CDS Sequence 103331201
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CTTCA)2
Repeat start & end within CDS Repeat start: 1245     Repeat end: 1254
Forward primer Primer sequence:   TGGAAAGATCTGCGCTGAGG     Tm(°C): 60.108     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CGAGGATCTGCTAGCATGGG     Tm(°C): 60.038     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 1088     End: 1423     Product size (bp): 336
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103331201     NCBI Gene Symbol: LOC103331201
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase 1; cytosolic-like      Other designations:   pyruvate kinase 1; cytosolic-like
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   plus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 9126346 ...... 9137988
CDS Sequence 103331201
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AGGCA)2
Repeat start & end within CDS Repeat start: 1370     Repeat end: 1379
Forward primer Primer sequence:   CAGACCAACAATGCCTGTGC     Tm(°C): 60.039     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CGAGGATCTGCTAGCATGGG     Tm(°C): 60.038     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 1286     End: 1423     Product size (bp): 138
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103331201     NCBI Gene Symbol: LOC103331201
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase 1; cytosolic-like      Other designations:   pyruvate kinase 1; cytosolic-like
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   plus     Exon count:   16
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 9126346 ...... 9137988
CDS Sequence 103331201
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GCTACCTTGTCAGGGCCATT     Tm(°C): 60.034     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GCCCCAAGTGCTTATGACCT     Tm(°C): 60.034     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 546     End: 647     Product size (bp): 102
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103333690     NCBI Gene Symbol: LOC103333690
Gene Aliases
Gene description & Other designations Description:   plastidial pyruvate kinase 2      Other designations:   plastidial pyruvate kinase 2
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   minus     Exon count:   12
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 25834523 ...... 25838488
CDS Sequence 103333690
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (GCTTC)2caaagttctggctcgcgaggaa(AAG)3
Repeat start & end within CDS Repeat start: 98     Repeat end: 138
Forward primer Primer sequence:   CTATGCGGGCGATTCAGAGT     Tm(°C): 59.967     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GTTGTTGAACTGCCCGGAAC     Tm(°C): 59.97     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 16     End: 273     Product size (bp): 258
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103333690     NCBI Gene Symbol: LOC103333690
Gene Aliases
Gene description & Other designations Description:   plastidial pyruvate kinase 2      Other designations:   plastidial pyruvate kinase 2
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   minus     Exon count:   12
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 25834523 ...... 25838488
CDS Sequence 103333690
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (CATTGC)2
Repeat start & end within CDS Repeat start: 1197     Repeat end: 1208
Forward primer Primer sequence:   TGGGGCTATGGTTGCAAGAG     Tm(°C): 60.034     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ATGGTTGCCTCTGTCCGAAG     Tm(°C): 60.036     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1019     End: 1321     Product size (bp): 303
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103333690     NCBI Gene Symbol: LOC103333690
Gene Aliases
Gene description & Other designations Description:   plastidial pyruvate kinase 2      Other designations:   plastidial pyruvate kinase 2
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   minus     Exon count:   12
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 25834523 ...... 25838488
CDS Sequence 103333690
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CTATGCGGGCGATTCAGAGT     Tm(°C): 59.967     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GTTGTTGAACTGCCCGGAAC     Tm(°C): 59.97     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 16     End: 273     Product size (bp): 258
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335036     NCBI Gene Symbol: LOC103335036
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase isozyme A; chloroplastic-like      Other designations:   pyruvate kinase isozyme A; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   LG6     Strand:   plus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024131.1      Gene Start and end within genomic accession: 6620150 ...... 6624641
CDS Sequence 103335036
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (AG)4
Repeat start & end within CDS Repeat start: 195     Repeat end: 202
Forward primer Primer sequence:   TGGCTGGCCATTCGATTCAT     Tm(°C): 60.107     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CCTCAACCCCAAAAACCCCT     Tm(°C): 60.105     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 16     End: 290     Product size (bp): 275
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335036     NCBI Gene Symbol: LOC103335036
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase isozyme A; chloroplastic-like      Other designations:   pyruvate kinase isozyme A; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   LG6     Strand:   plus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024131.1      Gene Start and end within genomic accession: 6620150 ...... 6624641
CDS Sequence 103335036
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (TCCAAC)2
Repeat start & end within CDS Repeat start: 1164     Repeat end: 1175
Forward primer Primer sequence:   ATCATGGTTGCTCGGGTTGA     Tm(°C): 59.672     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CGGTTTTCCTCACGACTCCA     Tm(°C): 59.967     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1020     End: 1333     Product size (bp): 314
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335036     NCBI Gene Symbol: LOC103335036
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase isozyme A; chloroplastic-like      Other designations:   pyruvate kinase isozyme A; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   LG6     Strand:   plus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024131.1      Gene Start and end within genomic accession: 6620150 ...... 6624641
CDS Sequence 103335036
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (TAGAAA)2
Repeat start & end within CDS Repeat start: 1761     Repeat end: 1772
Forward primer Primer sequence:   GTCACGCAACAGACCAAACC     Tm(°C): 59.971     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCTAACAGCAAGGTGGGAGG     Tm(°C): 60.035     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 1484     End: 1814     Product size (bp): 331
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335036     NCBI Gene Symbol: LOC103335036
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase isozyme A; chloroplastic-like      Other designations:   pyruvate kinase isozyme A; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   LG6     Strand:   plus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024131.1      Gene Start and end within genomic accession: 6620150 ...... 6624641
CDS Sequence 103335036
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (AAG)3
Repeat start & end within CDS Repeat start: 1858     Repeat end: 1866
Forward primer Primer sequence:   CCTCCCACCTTGCTGTTAGG     Tm(°C): 60.035     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TAAGAATTGGCCGGCACCAT     Tm(°C): 60.034     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1795     End: 1913     Product size (bp): 119
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335036     NCBI Gene Symbol: LOC103335036
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase isozyme A; chloroplastic-like      Other designations:   pyruvate kinase isozyme A; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   LG6     Strand:   plus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024131.1      Gene Start and end within genomic accession: 6620150 ...... 6624641
CDS Sequence 103335036
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TGGAGTCGTGAGGAAAACCG     Tm(°C): 59.967     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GGTTTGGTCTGTTGCGTGAC     Tm(°C): 59.971     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1314     End: 1503     Product size (bp): 190
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103336987     NCBI Gene Symbol: LOC103336987
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase isozyme G; chloroplastic      Other designations:   pyruvate kinase isozyme G; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG7     Strand:   minus     Exon count:   12
Gene Location within genomic sequence Genomic accession No. NC_024132.1      Gene Start and end within genomic accession: 4003050 ...... 4011142
CDS Sequence 103336987
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CAG)3
Repeat start & end within CDS Repeat start: 183     Repeat end: 191
Forward primer Primer sequence:   TGGCGACCCTTAATGTTCCC     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCCACAGGACCATTGTGTGA     Tm(°C): 59.89     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1     End: 223     Product size (bp): 223
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103336987     NCBI Gene Symbol: LOC103336987
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase isozyme G; chloroplastic      Other designations:   pyruvate kinase isozyme G; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG7     Strand:   minus     Exon count:   12
Gene Location within genomic sequence Genomic accession No. NC_024132.1      Gene Start and end within genomic accession: 4003050 ...... 4011142
CDS Sequence 103336987
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (ATTGCA)2
Repeat start & end within CDS Repeat start: 1192     Repeat end: 1203
Forward primer Primer sequence:   ATTGCTCGTGGAGACCTTGG     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCATGGGCAGTTTCTCCAGA     Tm(°C): 59.671     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1023     End: 1252     Product size (bp): 230
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103336987     NCBI Gene Symbol: LOC103336987
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase isozyme G; chloroplastic      Other designations:   pyruvate kinase isozyme G; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG7     Strand:   minus     Exon count:   12
Gene Location within genomic sequence Genomic accession No. NC_024132.1      Gene Start and end within genomic accession: 4003050 ...... 4011142
CDS Sequence 103336987
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (CAATT)2gagggccaataagagtcatatgggggaaatgtttgct(TTCCA)2
Repeat start & end within CDS Repeat start: 1337     Repeat end: 1393
Forward primer Primer sequence:   CTGGAGAAACTGCCCATGGA     Tm(°C): 59.671     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AAAGCACAGCCATGGATCCT     Tm(°C): 59.666     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1234     End: 1461     Product size (bp): 228
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103336987     NCBI Gene Symbol: LOC103336987
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase isozyme G; chloroplastic      Other designations:   pyruvate kinase isozyme G; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG7     Strand:   minus     Exon count:   12
Gene Location within genomic sequence Genomic accession No. NC_024132.1      Gene Start and end within genomic accession: 4003050 ...... 4011142
CDS Sequence 103336987
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (AT)4
Repeat start & end within CDS Repeat start: 1555     Repeat end: 1562
Forward primer Primer sequence:   AGGATCCATGGCTGTGCTTT     Tm(°C): 59.666     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GGTTGCGCACCACTTTGTAC     Tm(°C): 60.318     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1442     End: 1675     Product size (bp): 234
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103336987     NCBI Gene Symbol: LOC103336987
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase isozyme G; chloroplastic      Other designations:   pyruvate kinase isozyme G; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG7     Strand:   minus     Exon count:   12
Gene Location within genomic sequence Genomic accession No. NC_024132.1      Gene Start and end within genomic accession: 4003050 ...... 4011142
CDS Sequence 103336987
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GTGTGGTAGTTGATGGCGGA     Tm(°C): 60.037     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCAAGGTCTCCACGAGCAAT     Tm(°C): 60.036     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 733     End: 1042     Product size (bp): 310
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320916     NCBI Gene Symbol: LOC103320916
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase; cytosolic isozyme      Other designations:   pyruvate kinase; cytosolic isozyme
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   minus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 462054 ...... 464998
CDS Sequence 103320916
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TGGAA)2
Repeat start & end within CDS Repeat start: 756     Repeat end: 765
Forward primer Primer sequence:   GAGAATCAGGAAGGGGTGGC     Tm(°C): 60.107     GC (%): 60     Size: 20
Reverse primer Primer sequence:   CTGTGCCATCTAGAACCGCA     Tm(°C): 60.108     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 678     End: 933     Product size (bp): 256
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320916     NCBI Gene Symbol: LOC103320916
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase; cytosolic isozyme      Other designations:   pyruvate kinase; cytosolic isozyme
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   minus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 462054 ...... 464998
CDS Sequence 103320916
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TGT)3
Repeat start & end within CDS Repeat start: 1221     Repeat end: 1229
Forward primer Primer sequence:   AAGTACAGACCAGGCATGCC     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ATGCCTTGCTGGAGCTTCAT     Tm(°C): 60.033     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1191     End: 1289     Product size (bp): 99
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320916     NCBI Gene Symbol: LOC103320916
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase; cytosolic isozyme      Other designations:   pyruvate kinase; cytosolic isozyme
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   minus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 462054 ...... 464998
CDS Sequence 103320916
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TCCACCGGTATTCTATGCGC     Tm(°C): 59.967     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CACAGCGGCATTGAACCAAA     Tm(°C): 59.968     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 174     End: 453     Product size (bp): 280
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103323960     NCBI Gene Symbol: LOC103323960
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase isozyme A; chloroplastic      Other designations:   pyruvate kinase isozyme A; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   6
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 39411636 ...... 39416019
CDS Sequence 103323960
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (AACAC)2ctccttcctctcccccttcaatcgccggttaccggt(CAC)4
Repeat start & end within CDS Repeat start: 50     Repeat end: 107
Forward primer Primer sequence:   GTCTGTGCATCTCCTCACCC     Tm(°C): 60.108     GC (%): 60     Size: 20
Reverse primer Primer sequence:   GGAGCTGGAAAGAGCATGGT     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 8     End: 257     Product size (bp): 250
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103323960     NCBI Gene Symbol: LOC103323960
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase isozyme A; chloroplastic      Other designations:   pyruvate kinase isozyme A; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   6
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 39411636 ...... 39416019
CDS Sequence 103323960
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GTTGAGAAGCTTGGTCCCGA     Tm(°C): 59.965     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGGGAAGCATGGCATTACGT     Tm(°C): 60.035     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 717     End: 840     Product size (bp): 124
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103325792     NCBI Gene Symbol: LOC103325792
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase; cytosolic isozyme-like      Other designations:   pyruvate kinase; cytosolic isozyme-like
Chromosome, Strand & Exon count Chromosome:   LG3     Strand:   minus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024128.1      Gene Start and end within genomic accession: 8926017 ...... 8928067
CDS Sequence 103325792
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (ATCACC)2
Repeat start & end within CDS Repeat start: 310     Repeat end: 321
Forward primer Primer sequence:   GATTGTGTGCACGTTGGGAC     Tm(°C): 60.04     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GGGTTTCACATCCTCAGCCA     Tm(°C): 59.962     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 53     End: 395     Product size (bp): 343
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103325792     NCBI Gene Symbol: LOC103325792
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase; cytosolic isozyme-like      Other designations:   pyruvate kinase; cytosolic isozyme-like
Chromosome, Strand & Exon count Chromosome:   LG3     Strand:   minus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024128.1      Gene Start and end within genomic accession: 8926017 ...... 8928067
CDS Sequence 103325792
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (AGA)3
Repeat start & end within CDS Repeat start: 506     Repeat end: 514
Forward primer Primer sequence:   GCTGAGGATGTGAAACCCCA     Tm(°C): 59.962     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGAACCTTTGCGCACGAAAG     Tm(°C): 59.971     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 378     End: 641     Product size (bp): 264
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103325792     NCBI Gene Symbol: LOC103325792
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase; cytosolic isozyme-like      Other designations:   pyruvate kinase; cytosolic isozyme-like
Chromosome, Strand & Exon count Chromosome:   LG3     Strand:   minus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024128.1      Gene Start and end within genomic accession: 8926017 ...... 8928067
CDS Sequence 103325792
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GTG)3
Repeat start & end within CDS Repeat start: 1252     Repeat end: 1260
Forward primer Primer sequence:   TCTGACCAGAGGAGGAAGCA     Tm(°C): 59.885     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GAGAAGAGGCAGAACACCCC     Tm(°C): 60.036     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 1184     End: 1352     Product size (bp): 169
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103325792     NCBI Gene Symbol: LOC103325792
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase; cytosolic isozyme-like      Other designations:   pyruvate kinase; cytosolic isozyme-like
Chromosome, Strand & Exon count Chromosome:   LG3     Strand:   minus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024128.1      Gene Start and end within genomic accession: 8926017 ...... 8928067
CDS Sequence 103325792
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TGTGA)2
Repeat start & end within CDS Repeat start: 1506     Repeat end: 1515
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103325792     NCBI Gene Symbol: LOC103325792
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase; cytosolic isozyme-like      Other designations:   pyruvate kinase; cytosolic isozyme-like
Chromosome, Strand & Exon count Chromosome:   LG3     Strand:   minus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024128.1      Gene Start and end within genomic accession: 8926017 ...... 8928067
CDS Sequence 103325792
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GCTGAGGATGTGAAACCCCA     Tm(°C): 59.962     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGAACCTTTGCGCACGAAAG     Tm(°C): 59.971     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 378     End: 641     Product size (bp): 264
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327196     NCBI Gene Symbol: LOC103327196
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase; cytosolic isozyme      Other designations:   pyruvate kinase; cytosolic isozyme
Chromosome, Strand & Exon count Chromosome:   LG3     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024128.1      Gene Start and end within genomic accession: 24242783 ...... 24247109
CDS Sequence 103327196
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TGGAA)2
Repeat start & end within CDS Repeat start: 801     Repeat end: 810
Forward primer Primer sequence:   TGGTGTCGTCGTGGATCTTC     Tm(°C): 59.757     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CACAGGCTTCCCCACAAGAT     Tm(°C): 59.961     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 542     End: 881     Product size (bp): 340
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327196     NCBI Gene Symbol: LOC103327196
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase; cytosolic isozyme      Other designations:   pyruvate kinase; cytosolic isozyme
Chromosome, Strand & Exon count Chromosome:   LG3     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024128.1      Gene Start and end within genomic accession: 24242783 ...... 24247109
CDS Sequence 103327196
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TGTTG)2
Repeat start & end within CDS Repeat start: 1194     Repeat end: 1203
Forward primer Primer sequence:   CCCGTTGGAGAGTCTTGCAT     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GGAACAACCACCGACAGGAT     Tm(°C): 59.964     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1130     End: 1276     Product size (bp): 147
JBrowse View      JBrowse

Enzyme Id:  K00873
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327196     NCBI Gene Symbol: LOC103327196
Gene Aliases
Gene description & Other designations Description:   pyruvate kinase; cytosolic isozyme      Other designations:   pyruvate kinase; cytosolic isozyme
Chromosome, Strand & Exon count Chromosome:   LG3     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024128.1      Gene Start and end within genomic accession: 24242783 ...... 24247109
CDS Sequence 103327196
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TGTCGCCCGCTTTAACTTCT     Tm(°C): 59.966     GC (%): 50     Size: 20
Reverse primer Primer sequence:   AGTACGAATCTCAGGCCCCT     Tm(°C): 60.032     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 140     End: 275     Product size (bp): 136
JBrowse View      JBrowse