|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111454435 NCBI Gene Symbol: LOC111454435 |
| Gene Aliases | |
| Gene description & Other designations | Description: aspartate aminotransferase; chloroplastic-like Other designations: aspartate aminotransferase; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111454435 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (GAAATG)2 |
| Repeat start & end within CDS | Repeat start: 1120 Repeat end: 1131 |
| Forward primer | Primer sequence: AAAGAGGCTTGCTCGACCAA Tm(°C): 59.891 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: CCGTCCATCCTTCGTCATGT Tm(°C): 59.824 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 1016 End: 1316 Product size (bp): 301 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111454435 NCBI Gene Symbol: LOC111454435 |
| Gene Aliases | |
| Gene description & Other designations | Description: aspartate aminotransferase; chloroplastic-like Other designations: aspartate aminotransferase; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111454435 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: ATCCAACACCTGAGCAGTGG Tm(°C): 59.963 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GACCACGTTGATAGCCCCAA Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 751 End: 974 Product size (bp): 224 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111462770 NCBI Gene Symbol: LOC111462770 |
| Gene Aliases | |
| Gene description & Other designations | Description: aspartate aminotransferase; chloroplastic Other designations: aspartate aminotransferase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111462770 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (CATTC)2 |
| Repeat start & end within CDS | Repeat start: 111 Repeat end: 120 |
| Forward primer | Primer sequence: TATCCTCTCGCTTGCTTCCG Tm(°C): 59.614 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TCCCCTCAAACCGAGAGACA Tm(°C): 60.179 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 11 End: 186 Product size (bp): 176 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111462770 NCBI Gene Symbol: LOC111462770 |
| Gene Aliases | |
| Gene description & Other designations | Description: aspartate aminotransferase; chloroplastic Other designations: aspartate aminotransferase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111462770 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (GATGCA)2 |
| Repeat start & end within CDS | Repeat start: 841 Repeat end: 852 |
| Forward primer | Primer sequence: GGCAGCACCTGAAGGATCTT Tm(°C): 60.035 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CAAACCACGAGCAGCAAACA Tm(°C): 59.9 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 674 End: 884 Product size (bp): 211 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111462770 NCBI Gene Symbol: LOC111462770 |
| Gene Aliases | |
| Gene description & Other designations | Description: aspartate aminotransferase; chloroplastic Other designations: aspartate aminotransferase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111462770 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (GAAATG)2 |
| Repeat start & end within CDS | Repeat start: 1105 Repeat end: 1116 |
| Forward primer | Primer sequence: TGCAGCAACAAGGGTCAAGA Tm(°C): 60.107 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: ACGTGCCACTTGTCTGTCAT Tm(°C): 59.893 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 974 End: 1279 Product size (bp): 306 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111462770 NCBI Gene Symbol: LOC111462770 |
| Gene Aliases | |
| Gene description & Other designations | Description: aspartate aminotransferase; chloroplastic Other designations: aspartate aminotransferase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111462770 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GGCAGCACCTGAAGGATCTT Tm(°C): 60.035 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CAAACCACGAGCAGCAAACA Tm(°C): 59.9 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 674 End: 884 Product size (bp): 211 |
| JBrowse View | JBrowse |
