image


Statistics

Number of enzymes: 1
Total Number of designed primers: 9
Number of PGTM primers:     3
Number of PMTM primers:     6

Enzyme Id:  K00654
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103338231     NCBI Gene Symbol: LOC103338231
Gene Aliases
Gene description & Other designations Description:   long chain base biosynthesis protein 2a      Other designations:   long chain base biosynthesis protein 2a
Chromosome, Strand & Exon count Chromosome:   LG7     Strand:   plus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024132.1      Gene Start and end within genomic accession: 13111654 ...... 13114382
CDS Sequence 103338231
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (ATTGTC)2
Repeat start & end within CDS Repeat start: 727     Repeat end: 738
Forward primer Primer sequence:   TGTGACGAACTCTGCCATCC     Tm(°C): 60.037     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CTCCAATGCTGTGAGCCTCA     Tm(°C): 60.036     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 512     End: 846     Product size (bp): 335
JBrowse View      JBrowse

Enzyme Id:  K00654
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103338231     NCBI Gene Symbol: LOC103338231
Gene Aliases
Gene description & Other designations Description:   long chain base biosynthesis protein 2a      Other designations:   long chain base biosynthesis protein 2a
Chromosome, Strand & Exon count Chromosome:   LG7     Strand:   plus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024132.1      Gene Start and end within genomic accession: 13111654 ...... 13114382
CDS Sequence 103338231
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TGAGGCTCACAGCATTGGAG     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCGAGAACCTCAAAGCCCAT     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 827     End: 1180     Product size (bp): 354
JBrowse View      JBrowse

Enzyme Id:  K00654
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103330276     NCBI Gene Symbol: LOC103330276
Gene Aliases
Gene description & Other designations Description:   long chain base biosynthesis protein 2a-like      Other designations:   long chain base biosynthesis protein 2a-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   12
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 23123183 ...... 23126900
CDS Sequence 103330276
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (TAATTG)2
Repeat start & end within CDS Repeat start: 725     Repeat end: 736
Forward primer Primer sequence:   AATGGTGCACGAGGATCTGG     Tm(°C): 60.108     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TACTGCTCCAATGCTGTGGG     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 597     End: 851     Product size (bp): 255
JBrowse View      JBrowse

Enzyme Id:  K00654
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103330276     NCBI Gene Symbol: LOC103330276
Gene Aliases
Gene description & Other designations Description:   long chain base biosynthesis protein 2a-like      Other designations:   long chain base biosynthesis protein 2a-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   12
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 23123183 ...... 23126900
CDS Sequence 103330276
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GAA)3
Repeat start & end within CDS Repeat start: 1441     Repeat end: 1449
Forward primer Primer sequence:   AATTCCTGCCTTCTCACGGG     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCACTCCAACTTGAGCAACC     Tm(°C): 58.033     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1229     End: 1469     Product size (bp): 241
JBrowse View      JBrowse

Enzyme Id:  K00654
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103330276     NCBI Gene Symbol: LOC103330276
Gene Aliases
Gene description & Other designations Description:   long chain base biosynthesis protein 2a-like      Other designations:   long chain base biosynthesis protein 2a-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   12
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 23123183 ...... 23126900
CDS Sequence 103330276
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CCCACAGCATTGGAGCAGTA     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCCGTGAGAAGGCAGGAATT     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 832     End: 1248     Product size (bp): 417
JBrowse View      JBrowse

Enzyme Id:  K00654
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320363     NCBI Gene Symbol: LOC103320363
Gene Aliases
Gene description & Other designations Description:   long chain base biosynthesis protein 1      Other designations:   long chain base biosynthesis protein 1
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   13
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 10376127 ...... 10381124
CDS Sequence 103320363
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TTCTT)2
Repeat start & end within CDS Repeat start: 128     Repeat end: 137
Forward primer Primer sequence:   TGGATGCTCCCTCTTCTCGA     Tm(°C): 60.033     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCGCTTGGGTGGTTTGTAAC     Tm(°C): 59.687     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 58     End: 185     Product size (bp): 128
JBrowse View      JBrowse

Enzyme Id:  K00654
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320363     NCBI Gene Symbol: LOC103320363
Gene Aliases
Gene description & Other designations Description:   long chain base biosynthesis protein 1      Other designations:   long chain base biosynthesis protein 1
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   13
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 10376127 ...... 10381124
CDS Sequence 103320363
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CTGAT)2
Repeat start & end within CDS Repeat start: 1100     Repeat end: 1109
Forward primer Primer sequence:   GGTGTGCTTGGAAAAGCTGG     Tm(°C): 59.967     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GCTCGCTAATGAGAGGCCAA     Tm(°C): 60.179     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 858     End: 1181     Product size (bp): 324
JBrowse View      JBrowse

Enzyme Id:  K00654
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320363     NCBI Gene Symbol: LOC103320363
Gene Aliases
Gene description & Other designations Description:   long chain base biosynthesis protein 1      Other designations:   long chain base biosynthesis protein 1
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   13
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 10376127 ...... 10381124
CDS Sequence 103320363
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (ATCTG)2
Repeat start & end within CDS Repeat start: 1383     Repeat end: 1392
Forward primer Primer sequence:   GGCCTCTCATTAGCGAGCAA     Tm(°C): 60.179     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCCTTCAGCACCGAATCTGC     Tm(°C): 60.392     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1164     End: 1441     Product size (bp): 278
JBrowse View      JBrowse

Enzyme Id:  K00654
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320363     NCBI Gene Symbol: LOC103320363
Gene Aliases
Gene description & Other designations Description:   long chain base biosynthesis protein 1      Other designations:   long chain base biosynthesis protein 1
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   13
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 10376127 ...... 10381124
CDS Sequence 103320363
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GGTGTGCTTGGAAAAGCTGG     Tm(°C): 59.967     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGGCTAATGCGTGTCCCATT     Tm(°C): 60.035     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 858     End: 957     Product size (bp): 100
JBrowse View      JBrowse