image


Statistics

Number of enzymes: 1
Total Number of designed primers: 11
Number of PGTM primers:     4
Number of PMTM primers:     7
Number of Failed designed PMTM primers: 1

Enzyme Id:  K00469

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103340787     NCBI Gene Symbol: LOC103340787
Gene Aliases
Gene description & Other designations Description:   inositol oxygenase 1      Other designations:   inositol oxygenase 1
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   plus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 14398846 ...... 14402590
CDS Sequence 103340787
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CTT)3
Repeat start & end within CDS Repeat start: 523     Repeat end: 531
Forward primer Primer sequence:   CCCTGACTTGGATGAACCCC     Tm(°C): 60.034     GC (%): 60     Size: 20
Reverse primer Primer sequence:   GCACCCAAGAGGATGTGTGT     Tm(°C): 60.251     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 401     End: 590     Product size (bp): 190
JBrowse View      JBrowse

Enzyme Id:  K00469

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103340787     NCBI Gene Symbol: LOC103340787
Gene Aliases
Gene description & Other designations Description:   inositol oxygenase 1      Other designations:   inositol oxygenase 1
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   plus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 14398846 ...... 14402590
CDS Sequence 103340787
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TGGAC)2
Repeat start & end within CDS Repeat start: 693     Repeat end: 702
Forward primer Primer sequence:   ATCCTCTTGGGTGCGCTTTT     Tm(°C): 60.251     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TGTCTATAAGCCCCTGCCCT     Tm(°C): 60.03     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 577     End: 841     Product size (bp): 265
JBrowse View      JBrowse

Enzyme Id:  K00469

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103340787     NCBI Gene Symbol: LOC103340787
Gene Aliases
Gene description & Other designations Description:   inositol oxygenase 1      Other designations:   inositol oxygenase 1
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   plus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 14398846 ...... 14402590
CDS Sequence 103340787
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CCCTGACTTGGATGAACCCC     Tm(°C): 60.034     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TGTCTATAAGCCCCTGCCCT     Tm(°C): 60.03     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 401     End: 841     Product size (bp): 441
JBrowse View      JBrowse

Enzyme Id:  K00469

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103342639     NCBI Gene Symbol: LOC103342639
Gene Aliases
Gene description & Other designations Description:   inositol oxygenase 4-like      Other designations:   inositol oxygenase 4-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 103342639
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (TGCTTC)2
Repeat start & end within CDS Repeat start: 368     Repeat end: 379
Forward primer Primer sequence:   GATTGGCTGCACTTGACTGC     Tm(°C): 60.109     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGTGGTGAACAATGGCCTCA     Tm(°C): 59.815     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 324     End: 465     Product size (bp): 142
JBrowse View      JBrowse

Enzyme Id:  K00469

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103342639     NCBI Gene Symbol: LOC103342639
Gene Aliases
Gene description & Other designations Description:   inositol oxygenase 4-like      Other designations:   inositol oxygenase 4-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 103342639
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TTGGGCAGTCATTCAGGGAC     Tm(°C): 59.962     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACCACAGCCCATTGAGGAAG     Tm(°C): 59.961     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 52     End: 412     Product size (bp): 361
JBrowse View      JBrowse

Enzyme Id:  K00469

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103342863     NCBI Gene Symbol: LOC103342863
Gene Aliases
Gene description & Other designations Description:   inositol oxygenase 1-like      Other designations:   inositol oxygenase 1-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 103342863
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CTT)3
Repeat start & end within CDS Repeat start: 451     Repeat end: 459
Forward primer Primer sequence:   AGGTGAGAGGCAACCAAGTG     Tm(°C): 59.891     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACAGCCCATTGAGGAAGCTC     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 164     End: 490     Product size (bp): 327
JBrowse View      JBrowse

Enzyme Id:  K00469

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103342863     NCBI Gene Symbol: LOC103342863
Gene Aliases
Gene description & Other designations Description:   inositol oxygenase 1-like      Other designations:   inositol oxygenase 1-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 103342863
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (TC)5attgaaaagta(CTTCC)2
Repeat start & end within CDS Repeat start: 885     Repeat end: 915
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K00469

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103342863     NCBI Gene Symbol: LOC103342863
Gene Aliases
Gene description & Other designations Description:   inositol oxygenase 1-like      Other designations:   inositol oxygenase 1-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 103342863
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GAGCTTCCTCAATGGGCTGT     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCCGTACTGTGCTCTTGCTG     Tm(°C): 60.038     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 471     End: 855     Product size (bp): 385
JBrowse View      JBrowse

Enzyme Id:  K00469

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103321031     NCBI Gene Symbol: LOC103321031
Gene Aliases
Gene description & Other designations Description:   inositol oxygenase 1-like      Other designations:   inositol oxygenase 1-like
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   11
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 14029168 ...... 14032054
CDS Sequence 103321031
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TTC)5
Repeat start & end within CDS Repeat start: 29     Repeat end: 43
Forward primer Primer sequence:   TGCCTTCCTCCTCATCACCA     Tm(°C): 60.547     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGAAAGTGTGGCCAAATGCG     Tm(°C): 59.968     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1     End: 213     Product size (bp): 213
JBrowse View      JBrowse

Enzyme Id:  K00469

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103321031     NCBI Gene Symbol: LOC103321031
Gene Aliases
Gene description & Other designations Description:   inositol oxygenase 1-like      Other designations:   inositol oxygenase 1-like
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   11
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 14029168 ...... 14032054
CDS Sequence 103321031
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AAGAA)2
Repeat start & end within CDS Repeat start: 116     Repeat end: 125
Forward primer Primer sequence:   CCATCCTTGTTGAGCACCCT     Tm(°C): 59.961     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGAAAGTGTGGCCAAATGCG     Tm(°C): 59.968     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 76     End: 213     Product size (bp): 138
JBrowse View      JBrowse

Enzyme Id:  K00469

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103321031     NCBI Gene Symbol: LOC103321031
Gene Aliases
Gene description & Other designations Description:   inositol oxygenase 1-like      Other designations:   inositol oxygenase 1-like
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   11
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 14029168 ...... 14032054
CDS Sequence 103321031
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (TC)4
Repeat start & end within CDS Repeat start: 951     Repeat end: 958
Forward primer Primer sequence:   CTTTACACAGGGCAGGAGCA     Tm(°C): 59.963     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCTCAGCTTTGCGGGAAAGT     Tm(°C): 59.891     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 808     End: 1037     Product size (bp): 230
JBrowse View      JBrowse

Enzyme Id:  K00469

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103321031     NCBI Gene Symbol: LOC103321031
Gene Aliases
Gene description & Other designations Description:   inositol oxygenase 1-like      Other designations:   inositol oxygenase 1-like
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   11
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 14029168 ...... 14032054
CDS Sequence 103321031
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CACCTCTTGCAGACTGCTGA     Tm(°C): 59.966     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGTCGAGTCCACAACCTTCG     Tm(°C): 59.968     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 423     End: 696     Product size (bp): 274
JBrowse View      JBrowse