|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103340787 NCBI Gene Symbol: LOC103340787 |
Gene Aliases | |
Gene description & Other designations | Description: inositol oxygenase 1 Other designations: inositol oxygenase 1 |
Chromosome, Strand & Exon count | Chromosome: LG8 Strand: plus Exon count: 10 |
Gene Location within genomic sequence | Genomic accession No. NC_024133.1 Gene Start and end within genomic accession: 14398846 ...... 14402590 |
CDS Sequence | 103340787 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Penta Repeat sequence: (TGGAC)2 |
Repeat start & end within CDS | Repeat start: 693 Repeat end: 702 |
Forward primer | Primer sequence: ATCCTCTTGGGTGCGCTTTT Tm(°C): 60.251 GC (%): 50 Size: 20 |
Reverse primer | Primer sequence: TGTCTATAAGCCCCTGCCCT Tm(°C): 60.03 GC (%): 55 Size: 20 |
Primer start, end within sequence and product size | Start: 577 End: 841 Product size (bp): 265 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103340787 NCBI Gene Symbol: LOC103340787 |
Gene Aliases | |
Gene description & Other designations | Description: inositol oxygenase 1 Other designations: inositol oxygenase 1 |
Chromosome, Strand & Exon count | Chromosome: LG8 Strand: plus Exon count: 10 |
Gene Location within genomic sequence | Genomic accession No. NC_024133.1 Gene Start and end within genomic accession: 14398846 ...... 14402590 |
CDS Sequence | 103340787 |
| Marker Information | |
Marker Type | PGTM |
Repeat type & sequence | Repeat type: Repeat sequence: |
Repeat start & end within CDS | Repeat start: Repeat end: |
Forward primer | Primer sequence: CCCTGACTTGGATGAACCCC Tm(°C): 60.034 GC (%): 60 Size: 20 |
Reverse primer | Primer sequence: TGTCTATAAGCCCCTGCCCT Tm(°C): 60.03 GC (%): 55 Size: 20 |
Primer start, end within sequence and product size | Start: 401 End: 841 Product size (bp): 441 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103342639 NCBI Gene Symbol: LOC103342639 |
Gene Aliases | |
Gene description & Other designations | Description: inositol oxygenase 4-like Other designations: inositol oxygenase 4-like |
Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
CDS Sequence | 103342639 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Hexa Repeat sequence: (TGCTTC)2 |
Repeat start & end within CDS | Repeat start: 368 Repeat end: 379 |
Forward primer | Primer sequence: GATTGGCTGCACTTGACTGC Tm(°C): 60.109 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: TGTGGTGAACAATGGCCTCA Tm(°C): 59.815 GC (%): 50 Size: 20 |
Primer start, end within sequence and product size | Start: 324 End: 465 Product size (bp): 142 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103342639 NCBI Gene Symbol: LOC103342639 |
Gene Aliases | |
Gene description & Other designations | Description: inositol oxygenase 4-like Other designations: inositol oxygenase 4-like |
Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
CDS Sequence | 103342639 |
| Marker Information | |
Marker Type | PGTM |
Repeat type & sequence | Repeat type: Repeat sequence: |
Repeat start & end within CDS | Repeat start: Repeat end: |
Forward primer | Primer sequence: TTGGGCAGTCATTCAGGGAC Tm(°C): 59.962 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: ACCACAGCCCATTGAGGAAG Tm(°C): 59.961 GC (%): 55 Size: 20 |
Primer start, end within sequence and product size | Start: 52 End: 412 Product size (bp): 361 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103342863 NCBI Gene Symbol: LOC103342863 |
Gene Aliases | |
Gene description & Other designations | Description: inositol oxygenase 1-like Other designations: inositol oxygenase 1-like |
Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
CDS Sequence | 103342863 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Tri Repeat sequence: (CTT)3 |
Repeat start & end within CDS | Repeat start: 451 Repeat end: 459 |
Forward primer | Primer sequence: AGGTGAGAGGCAACCAAGTG Tm(°C): 59.891 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: ACAGCCCATTGAGGAAGCTC Tm(°C): 60.035 GC (%): 55 Size: 20 |
Primer start, end within sequence and product size | Start: 164 End: 490 Product size (bp): 327 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103342863 NCBI Gene Symbol: LOC103342863 |
Gene Aliases | |
Gene description & Other designations | Description: inositol oxygenase 1-like Other designations: inositol oxygenase 1-like |
Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
CDS Sequence | 103342863 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Compound Repeat sequence: (TC)5attgaaaagta(CTTCC)2 |
Repeat start & end within CDS | Repeat start: 885 Repeat end: 915 |
Forward primer | Primer sequence: None Tm(°C): GC (%): Size: |
Reverse primer | Primer sequence: None Tm(°C): GC (%): Size: |
Primer start, end within sequence and product size | Start: End: Product size (bp): |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103342863 NCBI Gene Symbol: LOC103342863 |
Gene Aliases | |
Gene description & Other designations | Description: inositol oxygenase 1-like Other designations: inositol oxygenase 1-like |
Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
CDS Sequence | 103342863 |
| Marker Information | |
Marker Type | PGTM |
Repeat type & sequence | Repeat type: Repeat sequence: |
Repeat start & end within CDS | Repeat start: Repeat end: |
Forward primer | Primer sequence: GAGCTTCCTCAATGGGCTGT Tm(°C): 60.035 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: TCCGTACTGTGCTCTTGCTG Tm(°C): 60.038 GC (%): 55 Size: 20 |
Primer start, end within sequence and product size | Start: 471 End: 855 Product size (bp): 385 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103321031 NCBI Gene Symbol: LOC103321031 |
Gene Aliases | |
Gene description & Other designations | Description: inositol oxygenase 1-like Other designations: inositol oxygenase 1-like |
Chromosome, Strand & Exon count | Chromosome: LG2 Strand: plus Exon count: 11 |
Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 14029168 ...... 14032054 |
CDS Sequence | 103321031 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Tri Repeat sequence: (TTC)5 |
Repeat start & end within CDS | Repeat start: 29 Repeat end: 43 |
Forward primer | Primer sequence: TGCCTTCCTCCTCATCACCA Tm(°C): 60.547 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: TGAAAGTGTGGCCAAATGCG Tm(°C): 59.968 GC (%): 50 Size: 20 |
Primer start, end within sequence and product size | Start: 1 End: 213 Product size (bp): 213 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103321031 NCBI Gene Symbol: LOC103321031 |
Gene Aliases | |
Gene description & Other designations | Description: inositol oxygenase 1-like Other designations: inositol oxygenase 1-like |
Chromosome, Strand & Exon count | Chromosome: LG2 Strand: plus Exon count: 11 |
Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 14029168 ...... 14032054 |
CDS Sequence | 103321031 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Penta Repeat sequence: (AAGAA)2 |
Repeat start & end within CDS | Repeat start: 116 Repeat end: 125 |
Forward primer | Primer sequence: CCATCCTTGTTGAGCACCCT Tm(°C): 59.961 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: TGAAAGTGTGGCCAAATGCG Tm(°C): 59.968 GC (%): 50 Size: 20 |
Primer start, end within sequence and product size | Start: 76 End: 213 Product size (bp): 138 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103321031 NCBI Gene Symbol: LOC103321031 |
Gene Aliases | |
Gene description & Other designations | Description: inositol oxygenase 1-like Other designations: inositol oxygenase 1-like |
Chromosome, Strand & Exon count | Chromosome: LG2 Strand: plus Exon count: 11 |
Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 14029168 ...... 14032054 |
CDS Sequence | 103321031 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Di Repeat sequence: (TC)4 |
Repeat start & end within CDS | Repeat start: 951 Repeat end: 958 |
Forward primer | Primer sequence: CTTTACACAGGGCAGGAGCA Tm(°C): 59.963 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: TCTCAGCTTTGCGGGAAAGT Tm(°C): 59.891 GC (%): 50 Size: 20 |
Primer start, end within sequence and product size | Start: 808 End: 1037 Product size (bp): 230 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103321031 NCBI Gene Symbol: LOC103321031 |
Gene Aliases | |
Gene description & Other designations | Description: inositol oxygenase 1-like Other designations: inositol oxygenase 1-like |
Chromosome, Strand & Exon count | Chromosome: LG2 Strand: plus Exon count: 11 |
Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 14029168 ...... 14032054 |
CDS Sequence | 103321031 |
| Marker Information | |
Marker Type | PGTM |
Repeat type & sequence | Repeat type: Repeat sequence: |
Repeat start & end within CDS | Repeat start: Repeat end: |
Forward primer | Primer sequence: CACCTCTTGCAGACTGCTGA Tm(°C): 59.966 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: TGTCGAGTCCACAACCTTCG Tm(°C): 59.968 GC (%): 55 Size: 20 |
Primer start, end within sequence and product size | Start: 423 End: 696 Product size (bp): 274 |
JBrowse View | JBrowse |