image


Statistics

Number of enzymes: 1
Total Number of designed primers: 18
Number of PGTM primers:     4
Number of PMTM primers:     14

Enzyme Id:  K00423

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103330351     NCBI Gene Symbol: LOC103330351
Gene Aliases
Gene description & Other designations Description:   L-ascorbate oxidase-like      Other designations:   L-ascorbate oxidase-like
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 12212833 ...... 12218692
CDS Sequence 103330351
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TTG)3
Repeat start & end within CDS Repeat start: 46     Repeat end: 54
Forward primer Primer sequence:   TGGCCACAAGTAGGAGACTA     Tm(°C): 57.384     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CTCCCTCAGTGTGGAGCTTG     Tm(°C): 60.037     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 1     End: 240     Product size (bp): 240
JBrowse View      JBrowse

Enzyme Id:  K00423

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103330351     NCBI Gene Symbol: LOC103330351
Gene Aliases
Gene description & Other designations Description:   L-ascorbate oxidase-like      Other designations:   L-ascorbate oxidase-like
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 12212833 ...... 12218692
CDS Sequence 103330351
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TGGCA)2
Repeat start & end within CDS Repeat start: 253     Repeat end: 262
Forward primer Primer sequence:   AACAAGCTCCACACTGAGGG     Tm(°C): 59.891     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCAGTCGCTCAACAAGAGGT     Tm(°C): 59.966     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 219     End: 503     Product size (bp): 285
JBrowse View      JBrowse

Enzyme Id:  K00423

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103330351     NCBI Gene Symbol: LOC103330351
Gene Aliases
Gene description & Other designations Description:   L-ascorbate oxidase-like      Other designations:   L-ascorbate oxidase-like
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 12212833 ...... 12218692
CDS Sequence 103330351
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TGG)4
Repeat start & end within CDS Repeat start: 782     Repeat end: 793
Forward primer Primer sequence:   TCGCTGGATTGGTGAACCTC     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGAGTAGCTCTCGCCTGAGT     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 554     End: 863     Product size (bp): 310
JBrowse View      JBrowse

Enzyme Id:  K00423

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103330351     NCBI Gene Symbol: LOC103330351
Gene Aliases
Gene description & Other designations Description:   L-ascorbate oxidase-like      Other designations:   L-ascorbate oxidase-like
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 12212833 ...... 12218692
CDS Sequence 103330351
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TGATG)2
Repeat start & end within CDS Repeat start: 1278     Repeat end: 1287
Forward primer Primer sequence:   CCCTCCTCAACACCCAGAAC     Tm(°C): 59.963     GC (%): 60     Size: 20
Reverse primer Primer sequence:   CGTTGTGTTCATGCCAAGCA     Tm(°C): 59.969     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1117     End: 1352     Product size (bp): 236
JBrowse View      JBrowse

Enzyme Id:  K00423

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103330351     NCBI Gene Symbol: LOC103330351
Gene Aliases
Gene description & Other designations Description:   L-ascorbate oxidase-like      Other designations:   L-ascorbate oxidase-like
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 12212833 ...... 12218692
CDS Sequence 103330351
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (AATGCC)2
Repeat start & end within CDS Repeat start: 1372     Repeat end: 1383
Forward primer Primer sequence:   TGCTTGGCATGAACACAACG     Tm(°C): 59.969     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CACTCCCATGCCCATATGCA     Tm(°C): 60.179     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1333     End: 1631     Product size (bp): 299
JBrowse View      JBrowse

Enzyme Id:  K00423

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103330351     NCBI Gene Symbol: LOC103330351
Gene Aliases
Gene description & Other designations Description:   L-ascorbate oxidase-like      Other designations:   L-ascorbate oxidase-like
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 12212833 ...... 12218692
CDS Sequence 103330351
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TGCTTGGCATGAACACAACG     Tm(°C): 59.969     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CACAAGCCAGAGCCTCAAGA     Tm(°C): 59.964     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1333     End: 1689     Product size (bp): 357
JBrowse View      JBrowse

Enzyme Id:  K00423

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103319513     NCBI Gene Symbol: LOC103319513
Gene Aliases
Gene description & Other designations Description:   L-ascorbate oxidase homolog      Other designations:   L-ascorbate oxidase homolog
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 339982 ...... 342143
CDS Sequence 103319513
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (CCA)3(ACA)3
Repeat start & end within CDS Repeat start: 182     Repeat end: 199
Forward primer Primer sequence:   ACCTATGGAACCCTCTCCCC     Tm(°C): 60.03     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TCCAAGGGTTCCATCTTGCC     Tm(°C): 59.96     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 99     End: 296     Product size (bp): 198
JBrowse View      JBrowse

Enzyme Id:  K00423

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103319513     NCBI Gene Symbol: LOC103319513
Gene Aliases
Gene description & Other designations Description:   L-ascorbate oxidase homolog      Other designations:   L-ascorbate oxidase homolog
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 339982 ...... 342143
CDS Sequence 103319513
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GGCCA)2
Repeat start & end within CDS Repeat start: 555     Repeat end: 564
Forward primer Primer sequence:   TGAACAGTCGCCTGCTCATT     Tm(°C): 59.965     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GAAGAGGGGCTCGTCTTTCC     Tm(°C): 60.108     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 427     End: 623     Product size (bp): 197
JBrowse View      JBrowse

Enzyme Id:  K00423

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103319513     NCBI Gene Symbol: LOC103319513
Gene Aliases
Gene description & Other designations Description:   L-ascorbate oxidase homolog      Other designations:   L-ascorbate oxidase homolog
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 339982 ...... 342143
CDS Sequence 103319513
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CGTAGGATGGGCATGGTCTC     Tm(°C): 59.966     GC (%): 60     Size: 20
Reverse primer Primer sequence:   ACAGTGTACCTGCTCACAGC     Tm(°C): 59.966     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 938     End: 1432     Product size (bp): 495
JBrowse View      JBrowse

Enzyme Id:  K00423

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103319616     NCBI Gene Symbol: LOC103319616
Gene Aliases
Gene description & Other designations Description:   L-ascorbate oxidase homolog      Other designations:   L-ascorbate oxidase homolog
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 324790 ...... 326970
CDS Sequence 103319616
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (CCA)3(ACA)3
Repeat start & end within CDS Repeat start: 182     Repeat end: 199
Forward primer Primer sequence:   ACCTATGGAACCCTCTCCCC     Tm(°C): 60.03     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TCCAAGGGTTCCATCTTGCC     Tm(°C): 59.96     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 99     End: 296     Product size (bp): 198
JBrowse View      JBrowse

Enzyme Id:  K00423

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103319616     NCBI Gene Symbol: LOC103319616
Gene Aliases
Gene description & Other designations Description:   L-ascorbate oxidase homolog      Other designations:   L-ascorbate oxidase homolog
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 324790 ...... 326970
CDS Sequence 103319616
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GGCCA)2
Repeat start & end within CDS Repeat start: 555     Repeat end: 564
Forward primer Primer sequence:   TGAACAGTCGCCTGCTCATT     Tm(°C): 59.965     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GAAGAGGGGCTCGTCTTTCC     Tm(°C): 60.108     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 427     End: 623     Product size (bp): 197
JBrowse View      JBrowse

Enzyme Id:  K00423

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103319734     NCBI Gene Symbol: LOC103319734
Gene Aliases
Gene description & Other designations Description:   L-ascorbate oxidase homolog      Other designations:   L-ascorbate oxidase homolog
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 344575 ...... 346723
CDS Sequence 103319734
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (CCA)3(ACA)3
Repeat start & end within CDS Repeat start: 182     Repeat end: 199
Forward primer Primer sequence:   ACCTATGGAACCCTCTCCCC     Tm(°C): 60.03     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TCCAAGGGTTCCATCTTGCC     Tm(°C): 59.96     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 99     End: 296     Product size (bp): 198
JBrowse View      JBrowse

Enzyme Id:  K00423

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103319734     NCBI Gene Symbol: LOC103319734
Gene Aliases
Gene description & Other designations Description:   L-ascorbate oxidase homolog      Other designations:   L-ascorbate oxidase homolog
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 344575 ...... 346723
CDS Sequence 103319734
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GGCCA)2
Repeat start & end within CDS Repeat start: 555     Repeat end: 564
Forward primer Primer sequence:   TGAACAGTCGCCTGCTCATT     Tm(°C): 59.965     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GAAGAGGGGCTCGTCTTTCC     Tm(°C): 60.108     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 427     End: 623     Product size (bp): 197
JBrowse View      JBrowse

Enzyme Id:  K00423

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103319734     NCBI Gene Symbol: LOC103319734
Gene Aliases
Gene description & Other designations Description:   L-ascorbate oxidase homolog      Other designations:   L-ascorbate oxidase homolog
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 344575 ...... 346723
CDS Sequence 103319734
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CATTCGACAGCGCTGGAATG     Tm(°C): 59.973     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TTTCTGAGGGAGCGTGCAAT     Tm(°C): 59.963     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1471     End: 1579     Product size (bp): 109
JBrowse View      JBrowse

Enzyme Id:  K00423

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103319834     NCBI Gene Symbol: LOC103319834
Gene Aliases
Gene description & Other designations Description:   L-ascorbate oxidase homolog      Other designations:   L-ascorbate oxidase homolog
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 356573 ...... 358697
CDS Sequence 103319834
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TCA)3
Repeat start & end within CDS Repeat start: 572     Repeat end: 580
Forward primer Primer sequence:   CTCCGCATCAACAGTCGTCT     Tm(°C): 60.109     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCATTGGGTGGCCTTGGATC     Tm(°C): 60.033     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 420     End: 714     Product size (bp): 295
JBrowse View      JBrowse

Enzyme Id:  K00423

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103319834     NCBI Gene Symbol: LOC103319834
Gene Aliases
Gene description & Other designations Description:   L-ascorbate oxidase homolog      Other designations:   L-ascorbate oxidase homolog
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 356573 ...... 358697
CDS Sequence 103319834
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GCTAT)2
Repeat start & end within CDS Repeat start: 1103     Repeat end: 1112
Forward primer Primer sequence:   ATCAACATCACCCGCACCAT     Tm(°C): 60.034     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CTTTTCTGGGGTCCACCTCC     Tm(°C): 59.962     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 1041     End: 1388     Product size (bp): 348
JBrowse View      JBrowse

Enzyme Id:  K00423

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103319834     NCBI Gene Symbol: LOC103319834
Gene Aliases
Gene description & Other designations Description:   L-ascorbate oxidase homolog      Other designations:   L-ascorbate oxidase homolog
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 356573 ...... 358697
CDS Sequence 103319834
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (TC)4
Repeat start & end within CDS Repeat start: 1554     Repeat end: 1561
Forward primer Primer sequence:   GGAGGTGGACCCCAGAAAAG     Tm(°C): 59.962     GC (%): 60     Size: 20
Reverse primer Primer sequence:   GGGGGCTTAGGCAAATCCTT     Tm(°C): 60.032     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1369     End: 1642     Product size (bp): 274
JBrowse View      JBrowse

Enzyme Id:  K00423

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103319834     NCBI Gene Symbol: LOC103319834
Gene Aliases
Gene description & Other designations Description:   L-ascorbate oxidase homolog      Other designations:   L-ascorbate oxidase homolog
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 356573 ...... 358697
CDS Sequence 103319834
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GATCCAAGGCCACCCAATGA     Tm(°C): 60.033     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ATGGTGCGGGTGATGTTGAT     Tm(°C): 60.034     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 695     End: 1060     Product size (bp): 366
JBrowse View      JBrowse