image


Statistics

Number of enzymes: 1
Total Number of designed primers: 2
Number of PGTM primers:     2

Enzyme Id:  K00419

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103339678     NCBI Gene Symbol: LOC103339678
Gene Aliases
Gene description & Other designations Description:   cytochrome b-c1 complex subunit 9-like      Other designations:   cytochrome b-c1 complex subunit 9-like
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   minus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 8232197 ...... 8234166
CDS Sequence 103339678
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GCGAGCGGGCTGTAGATTAT     Tm(°C): 60.038     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCATTCTTCCGACGGCCTTT     Tm(°C): 59.676     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 112     End: 218     Product size (bp): 107
JBrowse View      JBrowse

Enzyme Id:  K00419

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103332945     NCBI Gene Symbol: LOC103332945
Gene Aliases
Gene description & Other designations Description:   cytochrome b-c1 complex subunit 9-like      Other designations:   cytochrome b-c1 complex subunit 9-like
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   plus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 22275500 ...... 22277354
CDS Sequence 103332945
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   AACCAGTGGAGGCGTATTCG     Tm(°C): 60.108     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AACTCCATAATCCACGGCCC     Tm(°C): 59.817     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 20     End: 137     Product size (bp): 118
JBrowse View      JBrowse