image


Statistics

Number of enzymes: 1
Total Number of designed primers: 2
Number of PGTM primers:     1
Number of PMTM primers:     1

Enzyme Id:  K00413

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103330372     NCBI Gene Symbol: LOC103330372
Gene Aliases
Gene description & Other designations Description:   cytochrome c1-2; heme protein; mitochondrial      Other designations:   cytochrome c1-2; heme protein; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   8
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 23623251 ...... 23626537
CDS Sequence 103330372
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (TC)4
Repeat start & end within CDS Repeat start: 831     Repeat end: 838
Forward primer Primer sequence:   CCTCCAGCTGGTGTTTCGAT     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGCGGGACTTGAGAACTGAC     Tm(°C): 59.966     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 606     End: 897     Product size (bp): 292
JBrowse View      JBrowse

Enzyme Id:  K00413

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103330372     NCBI Gene Symbol: LOC103330372
Gene Aliases
Gene description & Other designations Description:   cytochrome c1-2; heme protein; mitochondrial      Other designations:   cytochrome c1-2; heme protein; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   8
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 23623251 ...... 23626537
CDS Sequence 103330372
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TGCATCCTGCCATTCCATGT     Tm(°C): 60.033     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GCTGCGGGAATCGATCACTA     Tm(°C): 59.968     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 308     End: 477     Product size (bp): 170
JBrowse View      JBrowse