image


Statistics

Number of enzymes: 1
Total Number of designed primers: 4
Number of PGTM primers:     2
Number of PMTM primers:     2

Enzyme Id:  K00286

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111432490     NCBI Gene Symbol: LOC111432490
Gene Aliases
Gene description & Other designations Description:   pyrroline-5-carboxylate reductase-like      Other designations:   pyrroline-5-carboxylate reductase-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111432490
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GTGAT)2
Repeat start & end within CDS Repeat start: 215     Repeat end: 224
Forward primer Primer sequence:   CTAGTCGCGGCATTGCTTTC     Tm(°C): 59.973     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CAGCAGCAACCGAAACCAAA     Tm(°C): 59.898     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 142     End: 318     Product size (bp): 177
JBrowse View      JBrowse

Enzyme Id:  K00286

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111432490     NCBI Gene Symbol: LOC111432490
Gene Aliases
Gene description & Other designations Description:   pyrroline-5-carboxylate reductase-like      Other designations:   pyrroline-5-carboxylate reductase-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111432490
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GCT)3
Repeat start & end within CDS Repeat start: 793     Repeat end: 801
Forward primer Primer sequence:   GCTTTGGCTGATGGAGGAGT     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACTTTGGGCCAAGTTCTCGG     Tm(°C): 60.537     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 573     End: 828     Product size (bp): 256
JBrowse View      JBrowse

Enzyme Id:  K00286

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111432490     NCBI Gene Symbol: LOC111432490
Gene Aliases
Gene description & Other designations Description:   pyrroline-5-carboxylate reductase-like      Other designations:   pyrroline-5-carboxylate reductase-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111432490
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CTAGTCGCGGCATTGCTTTC     Tm(°C): 59.973     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACTCCTCCATCAGCCAAAGC     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 142     End: 592     Product size (bp): 451
JBrowse View      JBrowse

Enzyme Id:  K00286

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111439386     NCBI Gene Symbol: LOC111439386
Gene Aliases
Gene description & Other designations Description:   pyrroline-5-carboxylate reductase-like      Other designations:   pyrroline-5-carboxylate reductase-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111439386
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CTCGAATCTCCACGGCTCTC     Tm(°C): 59.97     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TCTTCCCCAGTAGAGGCCTC     Tm(°C): 60.032     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 112     End: 291     Product size (bp): 180
JBrowse View      JBrowse