image


Statistics

Number of enzymes: 1
Total Number of designed primers: 11
Number of PGTM primers:     3
Number of PMTM primers:     8

Enzyme Id:  K00235
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103329740     NCBI Gene Symbol: LOC103329740
Gene Aliases
Gene description & Other designations Description:   succinate dehydrogenase [ubiquinone] iron-sulfur subunit 2; mitochondrial      Other designations:   succinate dehydrogenase [ubiquinone] iron-sulfur subunit 2; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 20365523 ...... 20367715
CDS Sequence 103329740
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (GTG)3cggggcatggcgtcggaggtccaggcccagcaagtggacctcaaggcc(
CAAGA)2
Repeat start & end within CDS Repeat start: 79     Repeat end: 145
Forward primer Primer sequence:   GAGGGCTATAGCTGCAGGTG     Tm(°C): 59.965     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TCTGGGTTCCACCGGTAGAT     Tm(°C): 59.958     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 17     End: 184     Product size (bp): 168
JBrowse View      JBrowse

Enzyme Id:  K00235
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103329740     NCBI Gene Symbol: LOC103329740
Gene Aliases
Gene description & Other designations Description:   succinate dehydrogenase [ubiquinone] iron-sulfur subunit 2; mitochondrial      Other designations:   succinate dehydrogenase [ubiquinone] iron-sulfur subunit 2; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 20365523 ...... 20367715
CDS Sequence 103329740
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (CGA)3taacgccgttgccgcacatgtttgtgataaaggacc(TGG)3acatgac
caacttctacaatcagtacaagagcatagagccgtggct(GAAGAG)2
Repeat start & end within CDS Repeat start: 407     Repeat end: 518
Forward primer Primer sequence:   TCACCTTCCGTCGATCTTGC     Tm(°C): 60.109     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCTCTTTCCCGGGCTCAGTA     Tm(°C): 59.959     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 292     End: 543     Product size (bp): 252
JBrowse View      JBrowse

Enzyme Id:  K00235
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103329740     NCBI Gene Symbol: LOC103329740
Gene Aliases
Gene description & Other designations Description:   succinate dehydrogenase [ubiquinone] iron-sulfur subunit 2; mitochondrial      Other designations:   succinate dehydrogenase [ubiquinone] iron-sulfur subunit 2; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 20365523 ...... 20367715
CDS Sequence 103329740
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GGATG)2
Repeat start & end within CDS Repeat start: 576     Repeat end: 585
Forward primer Primer sequence:   TACTGAGCCCGGGAAAGAGA     Tm(°C): 59.959     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TTATCGCATCCAGTCGCTCC     Tm(°C): 59.968     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 524     End: 738     Product size (bp): 215
JBrowse View      JBrowse

Enzyme Id:  K00235
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103329740     NCBI Gene Symbol: LOC103329740
Gene Aliases
Gene description & Other designations Description:   succinate dehydrogenase [ubiquinone] iron-sulfur subunit 2; mitochondrial      Other designations:   succinate dehydrogenase [ubiquinone] iron-sulfur subunit 2; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 20365523 ...... 20367715
CDS Sequence 103329740
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CCATA)2
Repeat start & end within CDS Repeat start: 765     Repeat end: 774
Forward primer Primer sequence:   GGAGCGACTGGATGCGATAA     Tm(°C): 59.968     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGTGATCTGCTTTCCAGGGT     Tm(°C): 58.933     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 719     End: 827     Product size (bp): 109
JBrowse View      JBrowse

Enzyme Id:  K00235
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103329740     NCBI Gene Symbol: LOC103329740
Gene Aliases
Gene description & Other designations Description:   succinate dehydrogenase [ubiquinone] iron-sulfur subunit 2; mitochondrial      Other designations:   succinate dehydrogenase [ubiquinone] iron-sulfur subunit 2; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 20365523 ...... 20367715
CDS Sequence 103329740
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GAGGGCTATAGCTGCAGGTG     Tm(°C): 59.965     GC (%): 60     Size: 20
Reverse primer Primer sequence:   CTCGTCTTGTCTTGGGCCTT     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 17     End: 148     Product size (bp): 132
JBrowse View      JBrowse

Enzyme Id:  K00235
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103332741     NCBI Gene Symbol: LOC103332741
Gene Aliases
Gene description & Other designations Description:   succinate dehydrogenase [ubiquinone] iron-sulfur subunit 3; mitochondrial-like      Other designations:   succinate dehydrogenase [ubiquinone] iron-sulfur subunit 3; mitochondrial-like
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 15363102 ...... 15365523
CDS Sequence 103332741
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CAA)3
Repeat start & end within CDS Repeat start: 213     Repeat end: 221
Forward primer Primer sequence:   GTGGCTTCAACAGGGTAGCT     Tm(°C): 59.963     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AACCATAGGACCGCAGTTGG     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 22     End: 272     Product size (bp): 251
JBrowse View      JBrowse

Enzyme Id:  K00235
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103332741     NCBI Gene Symbol: LOC103332741
Gene Aliases
Gene description & Other designations Description:   succinate dehydrogenase [ubiquinone] iron-sulfur subunit 3; mitochondrial-like      Other designations:   succinate dehydrogenase [ubiquinone] iron-sulfur subunit 3; mitochondrial-like
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 15363102 ...... 15365523
CDS Sequence 103332741
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AGGGA)2
Repeat start & end within CDS Repeat start: 337     Repeat end: 346
Forward primer Primer sequence:   CCAACTGCGGTCCTATGGTT     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AAACATGTGAGGCAGAGGGG     Tm(°C): 59.961     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 253     End: 458     Product size (bp): 206
JBrowse View      JBrowse

Enzyme Id:  K00235
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103332741     NCBI Gene Symbol: LOC103332741
Gene Aliases
Gene description & Other designations Description:   succinate dehydrogenase [ubiquinone] iron-sulfur subunit 3; mitochondrial-like      Other designations:   succinate dehydrogenase [ubiquinone] iron-sulfur subunit 3; mitochondrial-like
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 15363102 ...... 15365523
CDS Sequence 103332741
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GTGGCTTCAACAGGGTAGCT     Tm(°C): 59.963     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AACCATAGGACCGCAGTTGG     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 22     End: 272     Product size (bp): 251
JBrowse View      JBrowse

Enzyme Id:  K00235
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103332757     NCBI Gene Symbol: LOC103332757
Gene Aliases
Gene description & Other designations Description:   succinate dehydrogenase [ubiquinone] iron-sulfur subunit 3; mitochondrial-like      Other designations:   succinate dehydrogenase [ubiquinone] iron-sulfur subunit 3; mitochondrial-like
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 15368211 ...... 15370253
CDS Sequence 103332757
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CAA)3
Repeat start & end within CDS Repeat start: 213     Repeat end: 221
Forward primer Primer sequence:   GCTTCAACAGGGTAGCTCGA     Tm(°C): 59.753     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGGACCGCAGTTAGAGAGGT     Tm(°C): 59.96     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 25     End: 266     Product size (bp): 242
JBrowse View      JBrowse

Enzyme Id:  K00235
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103332757     NCBI Gene Symbol: LOC103332757
Gene Aliases
Gene description & Other designations Description:   succinate dehydrogenase [ubiquinone] iron-sulfur subunit 3; mitochondrial-like      Other designations:   succinate dehydrogenase [ubiquinone] iron-sulfur subunit 3; mitochondrial-like
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 15368211 ...... 15370253
CDS Sequence 103332757
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CCTGC)2
Repeat start & end within CDS Repeat start: 638     Repeat end: 647
Forward primer Primer sequence:   CCTCAGGCCCATAGATGCAG     Tm(°C): 59.964     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TTGCTCTGTGAACTCGTCCC     Tm(°C): 59.966     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 395     End: 740     Product size (bp): 346
JBrowse View      JBrowse

Enzyme Id:  K00235
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103332757     NCBI Gene Symbol: LOC103332757
Gene Aliases
Gene description & Other designations Description:   succinate dehydrogenase [ubiquinone] iron-sulfur subunit 3; mitochondrial-like      Other designations:   succinate dehydrogenase [ubiquinone] iron-sulfur subunit 3; mitochondrial-like
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 15368211 ...... 15370253
CDS Sequence 103332757
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GGGACGAGTTCACAGAGCAA     Tm(°C): 59.966     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GAGGCTTTTGGGGCAATTGG     Tm(°C): 60.036     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 721     End: 827     Product size (bp): 107
JBrowse View      JBrowse