image


Statistics

Number of enzymes: 1
Total Number of designed primers: 11
Number of PGTM primers:     2
Number of PMTM primers:     9

Enzyme Id:  K00231
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108192845     NCBI Gene Symbol: LOC108192845
Gene Aliases DCAR_021768
Gene description & Other designations Description:   protoporphyrinogen oxidase; mitochondrial      Other designations:   protoporphyrinogen oxidase; mitochondrial
Chromosome, Strand & Exon count Chromosome:   6     Strand:   minus     Exon count:   19
Gene Location within genomic sequence Genomic accession No. NC_030386.1      Gene Start and end within genomic accession: 19947129 ...... 19959770
CDS Sequence 108192845
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (AG)4
Repeat start & end within CDS Repeat start: 135     Repeat end: 142
Forward primer Primer sequence:   GTTGTTGGTGCTGGCGTTAG     Tm(°C): 60.04     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGTGTTTGCACCCTCATCCC     Tm(°C): 60.251     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 51     End: 203     Product size (bp): 153
JBrowse View      JBrowse

Enzyme Id:  K00231
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108192845     NCBI Gene Symbol: LOC108192845
Gene Aliases DCAR_021768
Gene description & Other designations Description:   protoporphyrinogen oxidase; mitochondrial      Other designations:   protoporphyrinogen oxidase; mitochondrial
Chromosome, Strand & Exon count Chromosome:   6     Strand:   minus     Exon count:   19
Gene Location within genomic sequence Genomic accession No. NC_030386.1      Gene Start and end within genomic accession: 19947129 ...... 19959770
CDS Sequence 108192845
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (TC)4
Repeat start & end within CDS Repeat start: 547     Repeat end: 554
Forward primer Primer sequence:   GCTGTTGGAGCCGTTTTTGT     Tm(°C): 59.898     GC (%): 50     Size: 20
Reverse primer Primer sequence:   AGAACGAACTGCGCCAACTA     Tm(°C): 59.967     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 389     End: 629     Product size (bp): 241
JBrowse View      JBrowse

Enzyme Id:  K00231
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108192845     NCBI Gene Symbol: LOC108192845
Gene Aliases DCAR_021768
Gene description & Other designations Description:   protoporphyrinogen oxidase; mitochondrial      Other designations:   protoporphyrinogen oxidase; mitochondrial
Chromosome, Strand & Exon count Chromosome:   6     Strand:   minus     Exon count:   19
Gene Location within genomic sequence Genomic accession No. NC_030386.1      Gene Start and end within genomic accession: 19947129 ...... 19959770
CDS Sequence 108192845
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (TTCATT)2
Repeat start & end within CDS Repeat start: 702     Repeat end: 713
Forward primer Primer sequence:   AGTTGGCGCAGTTCGTTCTA     Tm(°C): 59.967     GC (%): 50     Size: 20
Reverse primer Primer sequence:   ACCTCTTCGCAGAGTGCATC     Tm(°C): 60.108     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 611     End: 757     Product size (bp): 147
JBrowse View      JBrowse

Enzyme Id:  K00231
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108192845     NCBI Gene Symbol: LOC108192845
Gene Aliases DCAR_021768
Gene description & Other designations Description:   protoporphyrinogen oxidase; mitochondrial      Other designations:   protoporphyrinogen oxidase; mitochondrial
Chromosome, Strand & Exon count Chromosome:   6     Strand:   minus     Exon count:   19
Gene Location within genomic sequence Genomic accession No. NC_030386.1      Gene Start and end within genomic accession: 19947129 ...... 19959770
CDS Sequence 108192845
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TTATC)2
Repeat start & end within CDS Repeat start: 799     Repeat end: 808
Forward primer Primer sequence:   AGTTGGCGCAGTTCGTTCTA     Tm(°C): 59.967     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CTCAACTGCGATTCCTGGCT     Tm(°C): 60.392     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 611     End: 832     Product size (bp): 222
JBrowse View      JBrowse

Enzyme Id:  K00231
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108192845     NCBI Gene Symbol: LOC108192845
Gene Aliases DCAR_021768
Gene description & Other designations Description:   protoporphyrinogen oxidase; mitochondrial      Other designations:   protoporphyrinogen oxidase; mitochondrial
Chromosome, Strand & Exon count Chromosome:   6     Strand:   minus     Exon count:   19
Gene Location within genomic sequence Genomic accession No. NC_030386.1      Gene Start and end within genomic accession: 19947129 ...... 19959770
CDS Sequence 108192845
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GATAATCTCGGGCTTCGCGA     Tm(°C): 60.039     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGAACGAACTGCGCCAACTA     Tm(°C): 59.967     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 240     End: 629     Product size (bp): 390
JBrowse View      JBrowse

Enzyme Id:  K00231
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108204840     NCBI Gene Symbol: LOC108204840
Gene Aliases DCAR_002940
Gene description & Other designations Description:   protoporphyrinogen oxidase 1; chloroplastic      Other designations:   protoporphyrinogen oxidase 1; chloroplastic
Chromosome, Strand & Exon count Chromosome:   1     Strand:   minus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_030381.1      Gene Start and end within genomic accession: 34191684 ...... 34198394
CDS Sequence 108204840
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CTAAC)2
Repeat start & end within CDS Repeat start: 41     Repeat end: 50
Forward primer Primer sequence:   ACCTTCACCAAACTCCACCA     Tm(°C): 59.077     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CATCTGGATCTCCACCGTCG     Tm(°C): 59.969     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 6     End: 175     Product size (bp): 170
JBrowse View      JBrowse

Enzyme Id:  K00231
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108204840     NCBI Gene Symbol: LOC108204840
Gene Aliases DCAR_002940
Gene description & Other designations Description:   protoporphyrinogen oxidase 1; chloroplastic      Other designations:   protoporphyrinogen oxidase 1; chloroplastic
Chromosome, Strand & Exon count Chromosome:   1     Strand:   minus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_030381.1      Gene Start and end within genomic accession: 34191684 ...... 34198394
CDS Sequence 108204840
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (CGCCGG)2
Repeat start & end within CDS Repeat start: 126     Repeat end: 137
Forward primer Primer sequence:   TCATCCCAACCACTAACCGC     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CATCTGGATCTCCACCGTCG     Tm(°C): 59.969     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 52     End: 175     Product size (bp): 124
JBrowse View      JBrowse

Enzyme Id:  K00231
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108204840     NCBI Gene Symbol: LOC108204840
Gene Aliases DCAR_002940
Gene description & Other designations Description:   protoporphyrinogen oxidase 1; chloroplastic      Other designations:   protoporphyrinogen oxidase 1; chloroplastic
Chromosome, Strand & Exon count Chromosome:   1     Strand:   minus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_030381.1      Gene Start and end within genomic accession: 34191684 ...... 34198394
CDS Sequence 108204840
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TGG)3
Repeat start & end within CDS Repeat start: 443     Repeat end: 451
Forward primer Primer sequence:   TGGCGGGAATATTACGACGG     Tm(°C): 59.968     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ATTCCTCTCGACCTGGTGGA     Tm(°C): 59.959     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 353     End: 645     Product size (bp): 293
JBrowse View      JBrowse

Enzyme Id:  K00231
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108204840     NCBI Gene Symbol: LOC108204840
Gene Aliases DCAR_002940
Gene description & Other designations Description:   protoporphyrinogen oxidase 1; chloroplastic      Other designations:   protoporphyrinogen oxidase 1; chloroplastic
Chromosome, Strand & Exon count Chromosome:   1     Strand:   minus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_030381.1      Gene Start and end within genomic accession: 34191684 ...... 34198394
CDS Sequence 108204840
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (AGA)3
Repeat start & end within CDS Repeat start: 833     Repeat end: 841
Forward primer Primer sequence:   TCCACCAGGTCGAGAGGAAT     Tm(°C): 59.959     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GATCTCGGGGAGGCTTTGAG     Tm(°C): 59.894     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 626     End: 864     Product size (bp): 239
JBrowse View      JBrowse

Enzyme Id:  K00231
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108204840     NCBI Gene Symbol: LOC108204840
Gene Aliases DCAR_002940
Gene description & Other designations Description:   protoporphyrinogen oxidase 1; chloroplastic      Other designations:   protoporphyrinogen oxidase 1; chloroplastic
Chromosome, Strand & Exon count Chromosome:   1     Strand:   minus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_030381.1      Gene Start and end within genomic accession: 34191684 ...... 34198394
CDS Sequence 108204840
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TCCCA)2
Repeat start & end within CDS Repeat start: 1079     Repeat end: 1088
Forward primer Primer sequence:   GAGTTCCTCAAAGCCTCCCC     Tm(°C): 60.035     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TAGTGCCTCTGCTGCAACAA     Tm(°C): 59.892     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 839     End: 1139     Product size (bp): 301
JBrowse View      JBrowse

Enzyme Id:  K00231
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108204840     NCBI Gene Symbol: LOC108204840
Gene Aliases DCAR_002940
Gene description & Other designations Description:   protoporphyrinogen oxidase 1; chloroplastic      Other designations:   protoporphyrinogen oxidase 1; chloroplastic
Chromosome, Strand & Exon count Chromosome:   1     Strand:   minus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_030381.1      Gene Start and end within genomic accession: 34191684 ...... 34198394
CDS Sequence 108204840
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TCATCCCAACCACTAACCGC     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CATCTGGATCTCCACCGTCG     Tm(°C): 59.969     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 52     End: 175     Product size (bp): 124
JBrowse View      JBrowse