Statistics
Number of enzymes: 1
Total Number of designed primers: 8
Number of PGTM primers: 2
Number of PMTM primers: 6
Number of Failed designed PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 108219384 NCBI Gene Symbol: LOC108219384 |
| Gene Aliases | DCAR_013086 |
| Gene description & Other designations | Description: protochlorophyllide reductase; chloroplastic Other designations: protochlorophyllide reductase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 4 Strand: minus Exon count: 5 |
| Gene Location within genomic sequence | Genomic accession No. NC_030384.1 Gene Start and end within genomic accession: 32947855 ...... 32949967 |
| CDS Sequence | 108219384 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (GGAAG)2 |
| Repeat start & end within CDS | Repeat start: 251 Repeat end: 260 |
| Forward primer | Primer sequence: AGCTCTCTGAGGACCAGGAG Tm(°C): 60.033 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: TTCGGCCTTGAGAAAGTCCC Tm(°C): 59.964 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 129 End: 371 Product size (bp): 243 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 108219384 NCBI Gene Symbol: LOC108219384 |
| Gene Aliases | DCAR_013086 |
| Gene description & Other designations | Description: protochlorophyllide reductase; chloroplastic Other designations: protochlorophyllide reductase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 4 Strand: minus Exon count: 5 |
| Gene Location within genomic sequence | Genomic accession No. NC_030384.1 Gene Start and end within genomic accession: 32947855 ...... 32949967 |
| CDS Sequence | 108219384 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (AACACA)2 |
| Repeat start & end within CDS | Repeat start: 685 Repeat end: 696 |
| Forward primer | Primer sequence: GGGACTAACCATTTGGGCCA Tm(°C): 59.96 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TCGACGGTGGAATTCTTGCA Tm(°C): 59.966 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 576 End: 869 Product size (bp): 294 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 108219384 NCBI Gene Symbol: LOC108219384 |
| Gene Aliases | DCAR_013086 |
| Gene description & Other designations | Description: protochlorophyllide reductase; chloroplastic Other designations: protochlorophyllide reductase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 4 Strand: minus Exon count: 5 |
| Gene Location within genomic sequence | Genomic accession No. NC_030384.1 Gene Start and end within genomic accession: 32947855 ...... 32949967 |
| CDS Sequence | 108219384 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TGCAAGAATTCCACCGTCGA Tm(°C): 59.966 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: GCCAATCGCTTTCCGGATTC Tm(°C): 59.971 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 850 End: 1036 Product size (bp): 187 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 108228055 NCBI Gene Symbol: LOC108228055 |
| Gene Aliases | DCAR_021236 |
| Gene description & Other designations | Description: protochlorophyllide reductase Other designations: protochlorophyllide reductase |
| Chromosome, Strand & Exon count | Chromosome: 6 Strand: minus Exon count: 5 |
| Gene Location within genomic sequence | Genomic accession No. NC_030386.1 Gene Start and end within genomic accession: 24802609 ...... 24805594 |
| CDS Sequence | 108228055 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (AAGGA)2 |
| Repeat start & end within CDS | Repeat start: 246 Repeat end: 255 |
| Forward primer | Primer sequence: TAGAGCCCAGACTGCTGCTA Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TTGCTGTAGCCAGTCCCAAG Tm(°C): 59.963 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 185 End: 303 Product size (bp): 119 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 108228055 NCBI Gene Symbol: LOC108228055 |
| Gene Aliases | DCAR_021236 |
| Gene description & Other designations | Description: protochlorophyllide reductase Other designations: protochlorophyllide reductase |
| Chromosome, Strand & Exon count | Chromosome: 6 Strand: minus Exon count: 5 |
| Gene Location within genomic sequence | Genomic accession No. NC_030386.1 Gene Start and end within genomic accession: 24802609 ...... 24805594 |
| CDS Sequence | 108228055 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (ATGCA)2 |
| Repeat start & end within CDS | Repeat start: 501 Repeat end: 510 |
| Forward primer | Primer sequence: GCCAGTTTGCAGATGCCTTC Tm(°C): 60.109 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CCACCTGCAAGTCCCCTTAG Tm(°C): 60.035 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 448 End: 751 Product size (bp): 304 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 108228055 NCBI Gene Symbol: LOC108228055 |
| Gene Aliases | DCAR_021236 |
| Gene description & Other designations | Description: protochlorophyllide reductase Other designations: protochlorophyllide reductase |
| Chromosome, Strand & Exon count | Chromosome: 6 Strand: minus Exon count: 5 |
| Gene Location within genomic sequence | Genomic accession No. NC_030386.1 Gene Start and end within genomic accession: 24802609 ...... 24805594 |
| CDS Sequence | 108228055 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (CTG)3 |
| Repeat start & end within CDS | Repeat start: 610 Repeat end: 618 |
| Forward primer | Primer sequence: GCCATTTACTTGCCCACAGC Tm(°C): 60.109 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TGGCCCCATCAAATTCTCCC Tm(°C): 60.032 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 510 End: 807 Product size (bp): 298 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 108228055 NCBI Gene Symbol: LOC108228055 |
| Gene Aliases | DCAR_021236 |
| Gene description & Other designations | Description: protochlorophyllide reductase Other designations: protochlorophyllide reductase |
| Chromosome, Strand & Exon count | Chromosome: 6 Strand: minus Exon count: 5 |
| Gene Location within genomic sequence | Genomic accession No. NC_030386.1 Gene Start and end within genomic accession: 24802609 ...... 24805594 |
| CDS Sequence | 108228055 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (GAA)3 |
| Repeat start & end within CDS | Repeat start: 1009 Repeat end: 1017 |
| Forward primer | Primer sequence: GGGAGAATTTGATGGGGCCA Tm(°C): 60.032 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GAGGCAGAGTTGGTGTTCCA Tm(°C): 59.891 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 788 End: 1102 Product size (bp): 315 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 108228055 NCBI Gene Symbol: LOC108228055 |
| Gene Aliases | DCAR_021236 |
| Gene description & Other designations | Description: protochlorophyllide reductase Other designations: protochlorophyllide reductase |
| Chromosome, Strand & Exon count | Chromosome: 6 Strand: minus Exon count: 5 |
| Gene Location within genomic sequence | Genomic accession No. NC_030386.1 Gene Start and end within genomic accession: 24802609 ...... 24805594 |
| CDS Sequence | 108228055 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (AGC)3(TACTT)2 |
| Repeat start & end within CDS | Repeat start: 12 Repeat end: 30 |
| Forward primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Reverse primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Primer start, end within sequence and product size | Start: End: Product size (bp): |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 108228055 NCBI Gene Symbol: LOC108228055 |
| Gene Aliases | DCAR_021236 |
| Gene description & Other designations | Description: protochlorophyllide reductase Other designations: protochlorophyllide reductase |
| Chromosome, Strand & Exon count | Chromosome: 6 Strand: minus Exon count: 5 |
| Gene Location within genomic sequence | Genomic accession No. NC_030386.1 Gene Start and end within genomic accession: 24802609 ...... 24805594 |
| CDS Sequence | 108228055 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TAGAGCCCAGACTGCTGCTA Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TTGCTGTAGCCAGTCCCAAG Tm(°C): 59.963 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 185 End: 303 Product size (bp): 119 |
| JBrowse View | JBrowse |
