image


Statistics

Number of enzymes: 1
Total Number of designed primers: 8
Number of PGTM primers:     3
Number of PMTM primers:     5

Enzyme Id:  K00218
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101248079     NCBI Gene Symbol: LOC101248079
Gene Aliases
Gene description & Other designations Description:   protochlorophyllide reductase      Other designations:   protochlorophyllide reductase|light dependent NADH:protochlorophyllide oxidoreductase 1
Chromosome, Strand & Exon count Chromosome:   12     Strand:   minus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_015449.3      Gene Start and end within genomic accession: 4544776 ...... 4547635
CDS Sequence 101248079
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (TC)4
Repeat start & end within CDS Repeat start: 100     Repeat end: 107
Forward primer Primer sequence:   TCAAGCTGCTGCATTGCTTC     Tm(°C): 59.757     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TTACACCGGGAGATGCAACC     Tm(°C): 60.036     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 8     End: 213     Product size (bp): 206
JBrowse View      JBrowse

Enzyme Id:  K00218
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101248079     NCBI Gene Symbol: LOC101248079
Gene Aliases
Gene description & Other designations Description:   protochlorophyllide reductase      Other designations:   protochlorophyllide reductase|light dependent NADH:protochlorophyllide oxidoreductase 1
Chromosome, Strand & Exon count Chromosome:   12     Strand:   minus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_015449.3      Gene Start and end within genomic accession: 4544776 ...... 4547635
CDS Sequence 101248079
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (AGGACT)2
Repeat start & end within CDS Repeat start: 282     Repeat end: 293
Forward primer Primer sequence:   GGTTGCATCTCCCGGTGTAA     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGTCAAGCGATGCAAGGTCT     Tm(°C): 59.965     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 194     End: 441     Product size (bp): 248
JBrowse View      JBrowse

Enzyme Id:  K00218
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101248079     NCBI Gene Symbol: LOC101248079
Gene Aliases
Gene description & Other designations Description:   protochlorophyllide reductase      Other designations:   protochlorophyllide reductase|light dependent NADH:protochlorophyllide oxidoreductase 1
Chromosome, Strand & Exon count Chromosome:   12     Strand:   minus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_015449.3      Gene Start and end within genomic accession: 4544776 ...... 4547635
CDS Sequence 101248079
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (AAACAC)2
Repeat start & end within CDS Repeat start: 681     Repeat end: 692
Forward primer Primer sequence:   AGACCTTGCATCGCTTGACA     Tm(°C): 59.965     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GCTAAACCCCTCAAGTCCCC     Tm(°C): 60.034     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 422     End: 745     Product size (bp): 324
JBrowse View      JBrowse

Enzyme Id:  K00218
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101248079     NCBI Gene Symbol: LOC101248079
Gene Aliases
Gene description & Other designations Description:   protochlorophyllide reductase      Other designations:   protochlorophyllide reductase|light dependent NADH:protochlorophyllide oxidoreductase 1
Chromosome, Strand & Exon count Chromosome:   12     Strand:   minus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_015449.3      Gene Start and end within genomic accession: 4544776 ...... 4547635
CDS Sequence 101248079
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   AGCAGGGATGCCTAAGGAGA     Tm(°C): 60.031     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GCTAAACCCCTCAAGTCCCC     Tm(°C): 60.034     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 383     End: 745     Product size (bp): 363
JBrowse View      JBrowse

Enzyme Id:  K00218
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   543647     NCBI Gene Symbol: POR2
Gene Aliases
Gene description & Other designations Description:   protochlorophyllide reductase      Other designations:   protochlorophyllide reductase|light dependent NADH:protochlorophyllide oxidoreductase 2
Chromosome, Strand & Exon count Chromosome:   7     Strand:   minus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_015444.3      Gene Start and end within genomic accession: 62692833 ...... 62695968
CDS Sequence 543647
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GAA)3
Repeat start & end within CDS Repeat start: 1015     Repeat end: 1023
Forward primer Primer sequence:   GCATTGCCTTTGCTTCCCTC     Tm(°C): 60.108     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGCCTTCTCTGCATCACTGG     Tm(°C): 60.036     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 889     End: 1154     Product size (bp): 266
JBrowse View      JBrowse

Enzyme Id:  K00218
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   543647     NCBI Gene Symbol: POR2
Gene Aliases
Gene description & Other designations Description:   protochlorophyllide reductase      Other designations:   protochlorophyllide reductase|light dependent NADH:protochlorophyllide oxidoreductase 2
Chromosome, Strand & Exon count Chromosome:   7     Strand:   minus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_015444.3      Gene Start and end within genomic accession: 62692833 ...... 62695968
CDS Sequence 543647
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CCT)3
Repeat start & end within CDS Repeat start: 1100     Repeat end: 1108
Forward primer Primer sequence:   GCATTGCCTTTGCTTCCCTC     Tm(°C): 60.108     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGCCTTCTCTGCATCACTGG     Tm(°C): 60.036     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 889     End: 1154     Product size (bp): 266
JBrowse View      JBrowse

Enzyme Id:  K00218
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   543647     NCBI Gene Symbol: POR2
Gene Aliases
Gene description & Other designations Description:   protochlorophyllide reductase      Other designations:   protochlorophyllide reductase|light dependent NADH:protochlorophyllide oxidoreductase 2
Chromosome, Strand & Exon count Chromosome:   7     Strand:   minus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_015444.3      Gene Start and end within genomic accession: 62692833 ...... 62695968
CDS Sequence 543647
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CACTCCTGCAATCACCCAGT     Tm(°C): 59.963     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GATGGTTGGTGCCCACACTA     Tm(°C): 59.962     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 206     End: 591     Product size (bp): 386
JBrowse View      JBrowse

Enzyme Id:  K00218
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101244717     NCBI Gene Symbol: POR
Gene Aliases POR3
Gene description & Other designations Description:   protochlorophyllide oxidoreductase      Other designations:   protochlorophyllide oxidoreductase|light dependent NADH:protochlorophyllide oxidoreductase 3|protochlorophyllide reductase
Chromosome, Strand & Exon count Chromosome:   10     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_015447.3      Gene Start and end within genomic accession: 1328503 ...... 1332217
CDS Sequence 101244717
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GGACGACCTCTTGACGTGTT     Tm(°C): 59.968     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CGAGATTGGCCTTTGGAGGT     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 471     End: 720     Product size (bp): 250
JBrowse View      JBrowse