Statistics
Number of enzymes: 1
Total Number of designed primers: 2
Number of PGTM primers: 1
Number of PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 109823934 NCBI Gene Symbol: LOC109823934 |
| Gene Aliases | A4U43_C09F14410 |
| Gene description & Other designations | Description: dihydropyrimidine dehydrogenase (NADP(+)); chloroplastic Other designations: dihydropyrimidine dehydrogenase (NADP(+)); chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 9 Strand: plus Exon count: 7 |
| Gene Location within genomic sequence | Genomic accession No. NC_033802.1 Gene Start and end within genomic accession: 61673646 ...... 61680658 |
| CDS Sequence | 109823934 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (TCGGG)2 |
| Repeat start & end within CDS | Repeat start: 20 Repeat end: 29 |
| Forward primer | Primer sequence: ATGCCGAACCCGTTTGTTAT Tm(°C): 58.171 GC (%): 45 Size: 20 |
| Reverse primer | Primer sequence: ATTTGATCCCGCTGCTCGAA Tm(°C): 60.108 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 0 End: 173 Product size (bp): 174 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 109823934 NCBI Gene Symbol: LOC109823934 |
| Gene Aliases | A4U43_C09F14410 |
| Gene description & Other designations | Description: dihydropyrimidine dehydrogenase (NADP(+)); chloroplastic Other designations: dihydropyrimidine dehydrogenase (NADP(+)); chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 9 Strand: plus Exon count: 7 |
| Gene Location within genomic sequence | Genomic accession No. NC_033802.1 Gene Start and end within genomic accession: 61673646 ...... 61680658 |
| CDS Sequence | 109823934 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: AAGAGGGCGTTTGATGAGGG Tm(°C): 60.035 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: AGCATCCACTCCAGTCTCCT Tm(°C): 59.958 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 57 End: 374 Product size (bp): 318 |
| JBrowse View | JBrowse |
