|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103322229 NCBI Gene Symbol: LOC103322229 |
| Gene Aliases | |
| Gene description & Other designations | Description: pyruvate dehydrogenase E1 component subunit beta-1; mitochondrial Other designations: pyruvate dehydrogenase E1 component subunit beta-1; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG2 Strand: plus Exon count: 16 |
| Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 22136904 ...... 22142035 |
| CDS Sequence | 103322229 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (AAGGA)2 |
| Repeat start & end within CDS | Repeat start: 728 Repeat end: 737 |
| Forward primer | Primer sequence: AAAGCTGCCATTAGGGACCC Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CACCATGCTGAGGAAACCCT Tm(°C): 59.961 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 591 End: 930 Product size (bp): 340 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103322229 NCBI Gene Symbol: LOC103322229 |
| Gene Aliases | |
| Gene description & Other designations | Description: pyruvate dehydrogenase E1 component subunit beta-1; mitochondrial Other designations: pyruvate dehydrogenase E1 component subunit beta-1; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG2 Strand: plus Exon count: 16 |
| Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 22136904 ...... 22142035 |
| CDS Sequence | 103322229 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TGTCTGCAGACCCGAAAGTC Tm(°C): 59.966 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GGGTCCCTAATGGCAGCTTT Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 169 End: 610 Product size (bp): 442 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103325136 NCBI Gene Symbol: LOC103325136 |
| Gene Aliases | |
| Gene description & Other designations | Description: pyruvate dehydrogenase E1 component subunit beta-3; chloroplastic-like Other designations: pyruvate dehydrogenase E1 component subunit beta-3; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: minus Exon count: 4 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 4398855 ...... 4401534 |
| CDS Sequence | 103325136 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: ATGGCTAGGGATCCCACTGT Tm(°C): 60.03 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: AAGGGGTTGAGCATGCTACC Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 297 End: 699 Product size (bp): 403 |
| JBrowse View | JBrowse |
