image


Statistics

Number of enzymes: 1
Total Number of designed primers: 7
Number of PGTM primers:     2
Number of PMTM primers:     5
Number of Failed designed PMTM primers: 1

Enzyme Id:  K00028
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103331446     NCBI Gene Symbol: LOC103331446
Gene Aliases
Gene description & Other designations Description:   NAD-dependent malic enzyme 62 kDa isoform; mitochondrial      Other designations:   NAD-dependent malic enzyme 62 kDa isoform; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   plus     Exon count:   19
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 11894072 ...... 11905550
CDS Sequence 103331446
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (ATGTC)2
Repeat start & end within CDS Repeat start: 248     Repeat end: 257
Forward primer Primer sequence:   ACAGAGTCAGAATGGGCAGC     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCTGTCGTGCAATCGGTTCA     Tm(°C): 59.967     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 58     End: 380     Product size (bp): 323
JBrowse View      JBrowse

Enzyme Id:  K00028
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103331446     NCBI Gene Symbol: LOC103331446
Gene Aliases
Gene description & Other designations Description:   NAD-dependent malic enzyme 62 kDa isoform; mitochondrial      Other designations:   NAD-dependent malic enzyme 62 kDa isoform; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   plus     Exon count:   19
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 11894072 ...... 11905550
CDS Sequence 103331446
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TGC)3
Repeat start & end within CDS Repeat start: 672     Repeat end: 680
Forward primer Primer sequence:   GGCCCAGGGGAATGTACTTC     Tm(°C): 60.107     GC (%): 60     Size: 20
Reverse primer Primer sequence:   ACGGTGTCTTTGCAATCCCA     Tm(°C): 60.179     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 493     End: 782     Product size (bp): 290
JBrowse View      JBrowse

Enzyme Id:  K00028
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103331446     NCBI Gene Symbol: LOC103331446
Gene Aliases
Gene description & Other designations Description:   NAD-dependent malic enzyme 62 kDa isoform; mitochondrial      Other designations:   NAD-dependent malic enzyme 62 kDa isoform; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   plus     Exon count:   19
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 11894072 ...... 11905550
CDS Sequence 103331446
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (TTG)3(TGCTGG)2*
Repeat start & end within CDS Repeat start: 1034     Repeat end: 1052
Forward primer Primer sequence:   AGTGTTTACCCGTTGGCCTC     Tm(°C): 60.251     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCAGACCCTTGGCATCAACC     Tm(°C): 59.962     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 830     End: 1173     Product size (bp): 344
JBrowse View      JBrowse

Enzyme Id:  K00028
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103331446     NCBI Gene Symbol: LOC103331446
Gene Aliases
Gene description & Other designations Description:   NAD-dependent malic enzyme 62 kDa isoform; mitochondrial      Other designations:   NAD-dependent malic enzyme 62 kDa isoform; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   plus     Exon count:   19
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 11894072 ...... 11905550
CDS Sequence 103331446
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CGATGAGGCTCTCTTCGTCC     Tm(°C): 59.97     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TCTGTCGTGCAATCGGTTCA     Tm(°C): 59.967     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 19     End: 380     Product size (bp): 362
JBrowse View      JBrowse

Enzyme Id:  K00028
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103331878     NCBI Gene Symbol: LOC103331878
Gene Aliases
Gene description & Other designations Description:   NAD-dependent malic enzyme 2; mitochondrial      Other designations:   NAD-dependent malic enzyme 2; mitochondrial|NAD-dependent malic enzyme 59 kDa isoform; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   plus     Exon count:   22
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 15689407 ...... 15707915
CDS Sequence 103331878
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TCT)3
Repeat start & end within CDS Repeat start: 103     Repeat end: 111
Forward primer Primer sequence:   GCTATCACACTGCCCGATGT     Tm(°C): 60.179     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGGTCGATCGGGTCAAACTG     Tm(°C): 60.038     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 63     End: 222     Product size (bp): 160
JBrowse View      JBrowse

Enzyme Id:  K00028
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103331878     NCBI Gene Symbol: LOC103331878
Gene Aliases
Gene description & Other designations Description:   NAD-dependent malic enzyme 2; mitochondrial      Other designations:   NAD-dependent malic enzyme 2; mitochondrial|NAD-dependent malic enzyme 59 kDa isoform; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   plus     Exon count:   22
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 15689407 ...... 15707915
CDS Sequence 103331878
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CTAGT)2
Repeat start & end within CDS Repeat start: 1370     Repeat end: 1379
Forward primer Primer sequence:   TCCTATGGCTGCACCCTTTG     Tm(°C): 60.034     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CACATGGGGCTTGACCTTCT     Tm(°C): 59.961     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1310     End: 1409     Product size (bp): 100
JBrowse View      JBrowse

Enzyme Id:  K00028
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103331878     NCBI Gene Symbol: LOC103331878
Gene Aliases
Gene description & Other designations Description:   NAD-dependent malic enzyme 2; mitochondrial      Other designations:   NAD-dependent malic enzyme 2; mitochondrial|NAD-dependent malic enzyme 59 kDa isoform; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   plus     Exon count:   22
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 15689407 ...... 15707915
CDS Sequence 103331878
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (CT)9
Repeat start & end within CDS Repeat start: 8     Repeat end: 25
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K00028
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103331878     NCBI Gene Symbol: LOC103331878
Gene Aliases
Gene description & Other designations Description:   NAD-dependent malic enzyme 2; mitochondrial      Other designations:   NAD-dependent malic enzyme 2; mitochondrial|NAD-dependent malic enzyme 59 kDa isoform; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   plus     Exon count:   22
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 15689407 ...... 15707915
CDS Sequence 103331878
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TCCTATGGCTGCACCCTTTG     Tm(°C): 60.034     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCTGCGAGAAGTGCACCTAA     Tm(°C): 60.037     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1310     End: 1693     Product size (bp): 384
JBrowse View      JBrowse